Commit 2d45070d authored by Marc Duez's avatar Marc Duez
Browse files
parents 0e1f692e 54f274d1
......@@ -7,12 +7,13 @@ MAINCORE=$(wildcard *.cpp)
LIBCORE=core/vidjil.a
BINDIR=..
CGIDIR=../browser/cgi
CREATE_VERSION_GIT_H := $(shell test -x ./create-git-version-h.sh && ./create-git-version-h.sh)
.PHONY: all core clean forcedep
v: vidjil
v: vidjil align.cgi
###
......@@ -38,6 +39,12 @@ cleanspaced:
###
align.cgi: cgi/align.o
mkdir -p $(CGIDIR)
make -C core OPTIM="$(OPTIM)"
$(CC) -o $(CGIDIR)/align.cgi cgi/align.o $(LIBCORE) $(LDFLAGS) $(CXXFLAGS)
###
all: $(EXEC)
debug:
......@@ -50,7 +57,7 @@ $(EXEC): %: %.o
clean:
make -C core $@
rm -f *.o *.gcda *.gcno *.gcov
rm -f *.o *.gcda *.gcno *.gcov cgi/*.o
cd $(BINDIR) ; rm -f $(EXEC)
make -C tests $@
......
......@@ -6,7 +6,6 @@
#include <stdlib.h>
#include "../core/dynprog.h"
#include "../core/fasta.h"
#include "../core/msa.h"
#include "../core/lazy_msa.h"
using namespace std;
......
align: core align.o
mkdir -p ../../browser/cgi
g++ -o ../../browser/cgi/align.cgi align.o ../core/vidjil.a
align.o: align.cpp
g++ -c align.cpp
core:
cd .. ; make
!LAUNCH: export REQUEST_METHOD=POST ; export CONTENT_TYPE=test ; ../../browser/cgi/align.cgi < ../../data/msa.fa
$ seq1 (reference sequence for lazy msa)
1:-AT-GATCAGCC-TGAGAGATAC
$ seq2
1:-AT-CAAGAGCCATGAGAG----
$ seq3
1:GATAGAACAGC--TGAGAG----
>seq1
ATGATCAGCCTGAGAGATAC
>seq2
ATCAAGAGCCATGAGAG
>seq3
GATAGAACAGCTGAGAG
......@@ -18,10 +18,11 @@ These installation instruction are for Ubuntu server 14.04
git clone .... copy git repository
** Vidjil (algo) installation
/vidjil make compil command line program
/vidjil make vidjil compil main Vidjil program
/vidjil make align.cgi compil cgi
/vidjil/data make download/unzip stanford default file
/vidjil/germline make download germlines from IMGT
/vidjil/algo/cgi make compil cgi
** Vidjil (server) installation and initialization
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment