Attention une mise à jour du serveur va être effectuée le lundi 17 mai entre 13h et 13h30. Cette mise à jour va générer une interruption du service de quelques minutes.

Commit 2d028fcc authored by Mathieu Giraud's avatar Mathieu Giraud

should-vdj: BRI_TRB, typo in allele

parent 3ff57228
#target 0398AS
>TRBV27*01 29/CAAAG/3 JB2.7*02 [TRB]
# *01 ctcctacgagcagtacttcggg...
# *02 ctcctacgagcagtacGtcggg...
>TRBV27*01 29/CAAAG/3 TRBJ2-7*01 [TRB]
tgaatgttgaggtgactgataagggagatgttcctgaagggtacaaagtctctcgaaaagagaagaggaatt
tccccctgatcctggagtcgcccagccccaaccagacccaaagctacgagcagtacttcgggccgggcacca
ggctcacggttacaggtaag
tccccctgatcctggagtcgcccagccccaaccagacccaaag
ctacgagcagtacttcgggccgggcaccaggctcacggttacaggtaag
#target 0447GG
>TRBD2*02 1/AATG/0 TRBJ2-3*01 [TRB] BUG
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment