Commit 2c781b0b authored by flothoni's avatar flothoni

Revert "Add some test (remix them, just for stash save)"

This reverts commit 7674dc78.
parent 482d12db
analysis_data = {
"producer": "browser",
"timestamp": "2017-2-13 10:41:25",
"vidjil_json_version": "2014.09",
"samples": {
"id": [
"Diag.fa",
"Fu-2.fa",
],
"timestamp": [
"2014-10-20 13:59:02",
"2014-10-22 11:00:32",
],
"commandline": [
"./vidjil -c clones -g germline/ -r 1 -o ./out0 -z 200 -n 5 Diag.fa ",
"./vidjil -c clones -g germline/ -r 1 -o ./out1 -z 200 -n 5 Fu-0.fa ",
],
"number": 6,
"order": [
0,
1,
],
"names": [
"diag",
"fu2",
]
},
"clones": [
{
"id": "seqedited_in_analysis",
"sequence": "aaaaaaaaaaaaaaaaaaaag",
"tag": "0"
}
],
"clusters": [
[
"clone-001",
"clone2",
"clone5"
]
],
"tags": {
"names": {
"0": "clone 1",
"1": "clone 2",
"2": "clone 3",
"3": "standard",
"4": "standard (noise)",
"5": "custom 1",
"6": "custom 2",
"7": "custom 3",
"8": "-/-"
},
"hide": []
},
"normalization": {
"A": [],
"B": 0,
"id": -1
}
}
{
"vidjil_json_version": ["2014.09"],
"reads": {
"segmented": [5000,5000],
"total": [5000,5000],
"germline": {
"TRG": [5000,5000]
}
},
"samples": {
"timestamp": ["2014-10-20 13:59:02", "2014-11-20 14:03:13"],
"commandline": [
"./vidjil -c clones -g germline/ -r 1 -o ./out0 -z 200 -n 5 Diag.fa ",
"./vidjil -c clones -g germline/ -r 1 -o ./out2 -z 200 -n 5 Fu-2.fa "
],
"number": 2,
"original_names": [
"Diag.fa",
"Fu-2.fa"
],
"log": [
" ==> segmented 362296 reads (38.7%)\n ==> found 11526 40-windows in 335725 segments (35.8%) inside 937164 sequences\n ",
" ==> segmented 448435 reads (48.2%)\n ==> found 43444 40-windows in 418595 segments (45%) inside 929901 sequences\n "
]
},
"data": {
"dataTest1" : [45,50],
"dataTest2" : [2,20]
},
"clones": [
{
"id": "clone-001",
"sequence": "CTCATACACCCAGGAGGTGGAGCTGGATATTGATACTACGAAATCTAATTGAAAATGATTCTGGGGTCTATTACTGTGCCACCTGGGCCTTATTATAAGAAACTCTTTGGCAGTGGAAC",
"reads" : [ 241, 17 ],
"germline": "TRG",
"top": 1,
"seg":
{
"5": {"name": "TRGV5*01", "start": 1, "stop": 87, "delRight": 5},
"3": {"name": "TRGJ1*02", "start": 89, "stop": 118, "delLeft": 0}
}
},
{
"id": "clone2",
"sequence": "GATACA",
"reads": [ 153, 10221 ],
"germline": "TRG",
"top": 2
},
{
"id": "clone3",
"sequence": "ATACAGA",
"reads": [ 521, 42 ],
"germline": "TRG",
"top": 3,
"seg":
{
"5": {"start": 1, "stop": 100},
"3": {"start": 101, "stop": 200}
}
},
{
"id": "seqedited_in_analysis",
"name": "name_seqedited_in_analysis",
"sequence": "aaaaaaaaaaaaaaaaaaaag",
"reads": [ 521, 42 ],
"germline": "TRG",
"top": 4,
"seg":
{
"cdr3": {"start": 10, "stop": 20}
}
},
{
"id": "clone5",
"name": "clone_showOnlyOneSample",
"sequence": "GATACAaaaaaccccc",
"reads": [ 1021, 0 ],
"germline": "TRG",
"top": 5
}
]
}
\ No newline at end of file
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment