Commit 2c63ab6d authored by Mikaël Salson's avatar Mikaël Salson
Browse files

test_multilocus.rb, test_segmenter-page.rb: update variable name

Just to still have a meaningful variable name
parent ccb6b4a5
Pipeline #2266 passed with stages
......@@ -221,8 +221,8 @@ class TestMultilocus < BrowserTest
$b.segmenter_checkbox_imgt_vdj.wait_until_present
clone_info = $b.clone_info_segmenter('25')
productive_html = clone_info[:axis].element(:class => 'productivity-IMGT').title
assert (productive_html.include? 'productivity'), "IMGT should tell us the productivity of the sequence"
productive_title = clone_info[:axis].element(:class => 'productivity-IMGT').title
assert (productive_title.include? 'productivity'), "IMGT should tell us the productivity of the sequence"
clone_segmenter = $b.clone_in_segmenter('25')
$b.segmenter_checkbox_imgt_vdj.click
......
......@@ -105,8 +105,8 @@ GGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTACGACAT
Watir::Wait.until(timeout=10) { $b.span(:class => "identityBad").exists? }
clone_info = $b.clone_info_segmenter('0')
productive_html = clone_info[:axis].element(:class => 'productivity-IMGT').title
assert (productive_html.include? 'productivity'), "IMGT should tell us the productivity of the sequence"
productive_title = clone_info[:axis].element(:class => 'productivity-IMGT').title
assert (productive_title.include? 'productivity'), "IMGT should tell us the productivity of the sequence"
clone_segmenter = $b.clone_in_segmenter('0')
$b.segmenter_checkbox_imgt_vdj.click
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment