Commit 2c1c22bf authored by Marc Duez's avatar Marc Duez
Browse files
parents dec915eb cdca5bfc
......@@ -142,6 +142,14 @@ void MultiGermline::build_default_set(string path)
germline = new Germline("TRD", 'D', path + "/TRDV.fa", path + "/TRDD.fa", path + "/TRDJ.fa", 0, 80);
germline = new Germline("IGK", 'K', path + "/IGKV.fa", "", path + "/IGKJ.fa", -10, 20);
germline = new Germline("TRA", 'A', path + "/TRAV.fa", "", path + "/TRAJ.fa", -10, 20);
......@@ -151,15 +159,6 @@ void MultiGermline::build_default_set(string path)
germline = new Germline("TRD", 'D', path + "/TRDV.fa", path + "/TRDD.fa", path + "/TRDJ.fa", 0, 80);
germline = new Germline("IGK", 'K', path + "/IGKV.fa", "", path + "/IGKJ.fa", -10, 20);
germline = new Germline("IGL", 'L', path + "/IGLV.fa", "", path + "/IGLJ.fa", -10, 20);
......@@ -190,10 +189,10 @@ void MultiGermline::build_incomplete_set(string path)
germline = new Germline("IGK", 'k', path + "/IGKV.fa", "", path + "/IGK-KDE.fa", -10, 80);
germline = new Germline("IGK+", 'k', path + "/IGK-INTRON.fa", "", path + "/IGK-KDE.fa", -10, 80);
germline = new Germline("IGK", 'k', path + "/IGK-INTRON.fa", "", path + "/IGK-KDE.fa", -10, 80);
germline = new Germline("IGK+", 'k', path + "/IGKV.fa", "", path + "/IGK-KDE.fa", -10, 80);
......@@ -408,8 +408,15 @@ germline = {
"IGHV7-40*03": "ttttcaatagaaaagtcaaataatctaagtgtcaatcagtggatgattagataaaatatgatatatgtaaatcatggaatactatgcagccagtatggtatgaattcagtgtgaccagcccctggacaagggcttgagtggatgggatggatcatcacctacactgggaacccaacatataccaacggcttcacaggacggtttctattctccatggacacctctgtcagcatggcgtatctgcagatcagcagcctaaaggctgaggacacggccgtgtatgactgtatgagaga",
"IGHV7-81*01": "caggtgcagctggtgcagtctggccatgaggtgaagcagcctggggcctcagtgaaggtctcctgcaaggcttctggttacagtttcaccacctatggtatgaattgggtgccacaggcccctggacaagggcttgagtggatgggatggttcaacacctacactgggaacccaacatatgcccagggcttcacaggacggtttgtcttctccatggacacctctgccagcacagcatacctgcagatcagcagcctaaaggctgaggacatggccatgtattactgtgcgagata"
"IGKJ": {
"IGHV7-81*01": "caggtgcagctggtgcagtctggccatgaggtgaagcagcctggggcctcagtgaaggtctcctgcaaggcttctggttacagtttcaccacctatggtatgaattgggtgccacaggcccctggacaagggcttgagtggatgggatggttcaacacctacactgggaacccaacatatgcccagggcttcacaggacggtttgtcttctccatggacacctctgccagcacagcatacctgcagatcagcagcctaaaggctgaggacatggccatgtattactgtgcgagata",
"IGK-KDE": {
"IGKJ5*01": "gatcaccttcggccaagggacacgactggagattaaac",
"IGKJ": {
"IGKJ1*01": "gtggacgttcggccaagggaccaaggtggaaatcaaac",
"IGKJ2*01": "tgtacacttttggccaggggaccaagctggagatcaaac",
"IGKJ2*02": "gtgcacttttggccaggggaccaagctggagatcaaac",
......@@ -418,10 +425,10 @@ germline = {
"IGKJ3*01": "attcactttcggccctgggaccaaagtggatatcaaac",
"IGKJ4*01": "gctcactttcggcggagggaccaaggtggagatcaaac",
"IGKJ4*02": "gctcacgttcggcggagggaccaaggtggagatcaaac",
"IGKJ5*01": "gatcaccttcggccaagggacacgactggagattaaac"
"IGKJ5*01": "gatcaccttcggccaagggacacgactggagattaaac",
"IGKV": {
"IGKJ5*01": "gatcaccttcggccaagggacacgactggagattaaac",
"IGKV1-12*01": "gacatccagatgacccagtctccatcttccgtgtctgcatctgtaggagacagagtcaccatcacttgtcgggcgagtcagggtattagcagctggttagcctggtatcagcagaaaccagggaaagcccctaagctcctgatctatgctgcatccagtttgcaaagtggggtcccatcaaggttcagcggcagtggatctgggacagatttcactctcaccatcagcagcctgcagcctgaagattttgcaacttactattgtcaacaggctaacagtttccctcc",
"IGKV1-12*02": "gacatccagatgacccagtctccatcttccgtgtctgcatctgtaggagacagagtcaccatcacttgtcgggcgagtcagggtattagcagctggttagcctggtatcagcagaaaccagggaaagcccctaagctcctgatctatgctgcatccagtttgcaaagtggggtcccatcaaggttcagcggcagtggatctgggacagatttcactctcaccatcagcagcctgcagcctgaagattttgcaacttactattgtcaacaggctaacagtttcccttc",
"IGKV1-13*01": "gccatccagttgacccagtctccatcctccctgtctgcatctgtaggagacagagtcaccatcacttgccgggcaagtcagggcattagcagtgctttagcctgatatcagcagaaaccagggaaagctcctaagctcctgatctatgatgcctccagtttggaaagtggggtcccatcaaggttcagcggcagtggatctgggacagatttcactctcaccatcagcagcctgcagcctgaagattttgcaacttattactgtcaacagtttaataattaccctca",
......@@ -522,7 +529,8 @@ germline = {
"IGKV6-21*01": "gaaattgtgctgactcagtctccagactttcagtctgtgactccaaaggagaaagtcaccatcacctgccgggccagtcagagcattggtagtagcttacactggtaccagcagaaaccagatcagtctccaaagctcctcatcaagtatgcttcccagtccttctcaggggtcccctcgaggttcagtggcagtggatctgggacagatttcaccctcaccatcaatagcctggaagctgaagatgctgcaacgtattactgtcatcagagtagtagtttacctca",
"IGKV6D-21*01": "gaaattgtgctgactcagtctccagactttcagtctgtgactccaaaggagaaagtcaccatcacctgccgggccagtcagagcattggtagtagcttacactggtaccagcagaaaccagatcagtctccaaagctcctcatcaagtatgcttcccagtccttctcaggggtcccctcgaggttcagtggcagtggatctgggacagatttcaccctcaccatcaatagcctggaagctgaagatgctgcaacgtattactgtcatcagagtagtagtttacctca",
"IGKV6D-41*01": "gatgttgtgatgacacagtctccagctttcctctctgtgactccaggggagaaagtcaccatcacctgccaggccagtgaaggcattggcaactacttatactggtaccagcagaaaccagatcaagccccaaagctcctcatcaagtatgcttcccagtccatctcaggggtcccctcgaggttcagtggcagtggatctgggacagatttcacctttaccatcagtagcctggaagctgaagatgctgcaacatattactgtcagcagggcaataagcaccctca",
"IGKV7-3*01": "gacattgtgctgacccagtctccagcctccttggccgtgtctccaggacagagggccaccatcacctgcagagccagtgagagtgtcagtttcttgggaataaacttaattcactggtatcagcagaaaccaggacaacctcctaaactcctgatttaccaagcatccaataaagacactggggtcccagccaggttcagcggcagtgggtctgggaccgatttcaccctcacaattaatcctgtggaagctaatgatactgcaaattattactgtctgcagagtaagaattttcct"
"IGKV7-3*01": "gacattgtgctgacccagtctccagcctccttggccgtgtctccaggacagagggccaccatcacctgcagagccagtgagagtgtcagtttcttgggaataaacttaattcactggtatcagcagaaaccaggacaacctcctaaactcctgatttaccaagcatccaataaagacactggggtcccagccaggttcagcggcagtgggtctgggaccgatttcaccctcacaattaatcctgtggaagctaatgatactgcaaattattactgtctgcagagtaagaattttcct",
"IGLJ": {
"IGKV7-3*01": "gacattgtgctgacccagtctccagcctccttggccgtgtctccaggacagagggccaccatcacctgcagagccagtgagagtgtcagtttcttgggaataaacttaattcactggtatcagcagaaaccaggacaacctcctaaactcctgatttaccaagcatccaataaagacactggggtcccagccaggttcagcggcagtgggtctgggaccgatttcaccctcacaattaatcctgtggaagctaatgatactgcaaattattactgtctgcagagtaagaattttcct",
......@@ -975,17 +983,19 @@ germline = {
"TRBV9*03": "gattctggagtcacacaaaccccaaagcacctgatcacagcaactggacagcgagtgacgctgagatgctcccctaggtctggagacctctctgtgtactggtaccaacagagcctggaccagggcctccagttcctcattcaatattataatggagaagagagagcaaaaggaaacattcttgaacgattctccgcacaacagttccctgacttgcactctgaactaaacctgagctctctggagctgggggactcagctttgtatttctgtgccagcagc"
"TRDD": {
"TRBV9*03": "gattctggagtcacacaaaccccaaagcacctgatcacagcaactggacagcgagtgacgctgagatgctcccctaggtctggagacctctctgtgtactggtaccaacagagcctggaccagggcctccagttcctcattcaatattataatggagaagagagagcaaaaggaaacattcttgaacgattctccgcacaacagttccctgacttgcactctgaactaaacctgagctctctggagctgggggactcagctttgtatttctgtgccagcagc",
"TRDD1*01": "gaaatagt",
"TRDD2*01": "ccttcctac",
"TRDD3*01": "actgggggatacg"
"TRDD2": {
"TRDD2*01": "tatactgatgtgtttcattgtgccttcctac"
"TRDD2-01": {
"TRDD2*01": "ccttcctac",
"TRDD3*01": "actgggggatacg"
"TRBV9*03": "gattctggagtcacacaaaccccaaagcacctgatcacagcaactggacagcgagtgacgctgagatgctcccctaggtctggagacctctctgtgtactggtaccaacagagcctggaccagggcctccagttcctcattcaatattataatggagaagagagagcaaaaggaaacattcttgaacgattctccgcacaacagttccctgacttgcactctgaactaaacctgagctctctggagctgggggactcagctttgtatttctgtgccagcagc",
"TRDD2*01": "ccttcctac"
"TRDD3-01": {
"TRDD2*01": "ccttcctac",
"TRDD2*01": "tatactgatgtgtttcattgtgccttcctac",
"TRDD3*01": "actgggggatacg"
"TRDJ": {
......@@ -1085,10 +1095,11 @@ germline_data = {
"TRD+": {
"shortcut": "d",
"color" : "#d5a920",
"description": "Human T-cell receptor, delta locus (14q11.2), incomplete Dd2-Dd3 rearrangements",
"follows": "TRD",
"5": ["TRDV.fa", "TRDD-d2.fa"],
"3": ["TRDJ.fa", "TRDD-d3.fa"]
"5": ["TRDV.fa", "TRDD2-01.fa"],
"3": ["TRDJ.fa", "TRDD3-01.fa"]
"IGH": {
......@@ -1104,6 +1115,7 @@ germline_data = {
"IGH+": {
"shortcut": "h",
"color" : "#d5a920",
"description": "Human immunoglobulin, heavy locus (14q32.33), incomplete DH-JH rearrangements",
"follows": "IGH",
"5": ["IGHD.fa"],
......@@ -1122,10 +1134,11 @@ germline_data = {
"IGK+": {
"shortcut": "k",
"color" : "#4ac1a8",
"description": "Human immunoglobulin, kappa locus (2p11.2), Vk-KDE and Intron-KDE rearrangements",
"follows": "IGK",
"5": ["IGKV.fa", "INTRON.fa"],
"3": ["KDE.fa"]
"5": ["IGKV.fa", "IGK-INTRON.fa"],
"3": ["IGK-KDE.fa"]
"IGL": {
......@@ -47,6 +47,7 @@ germline_data = {
"TRD+": {
"shortcut": "d",
"color" : "#d5a920",
"description": "Human T-cell receptor, delta locus (14q11.2), incomplete Dd2-Dd3 rearrangements",
"follows": "TRD",
"5": ["TRDV.fa", "TRDD2-01.fa"],
......@@ -66,6 +67,7 @@ germline_data = {
"IGH+": {
"shortcut": "h",
"color" : "#8c91e4",
"description": "Human immunoglobulin, heavy locus (14q32.33), incomplete DH-JH rearrangements",
"follows": "IGH",
"5": ["IGHD.fa"],
......@@ -84,6 +86,7 @@ germline_data = {
"IGK+": {
"shortcut": "k",
"color" : "#4ac1a8",
"description": "Human immunoglobulin, kappa locus (2p11.2), Vk-KDE and Intron-KDE rearrangements",
"follows": "IGK",
"5": ["IGKV.fa", "IGK-INTRON.fa"],
......@@ -130,7 +130,7 @@ server {
ssl_session_cache shared:SSL:10m;
ssl_session_timeout 10m;
ssl_protocols SSLv3 TLSv1;
ssl_protocols TLSv1 TLSv1.1 TLSv1.2;
keepalive_timeout 70;
location / {
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment