Commit 2b601b25 authored by Yann Ferret's avatar Yann Ferret Committed by Mathieu Giraud

tests: one more curated sequence in should-vdj-tests/0119-lil

parent 01fd38fb
......@@ -2,6 +2,10 @@
>TRGV9*01_8/CTCACGAGGG/3_TRGJP1*01__TRG
CGGCACTGTCAGAAAGGAATCCGGCATTCCGTCAGGCAAATTTGAGGTGGATAGGATACCTGAAACGTCTACATCCACTCTCACCATTCACAATGTAGAGAAACAGGACATAGCTACCTACTACTGTGCCTGTCTCACGAGGGCCACTGGTTGGTTCAAGATATTTGCTGAAGGGACTAAGCTCATAGTAACTTCGCCTGGTAA
# Intron -2/0/-10 KDE ?
>Intron 2/0/9 KDE [IGK+]
CGTGGCACCGCGAGCTGTAGACAGAGCCGCGGTCTTTCTCGATTGAGTGGCTTTGGTGGCCATGCCACCGCGCTCTTGGGGCAGCCGCCTTGCCGCTAGTGGCCGTGGCCACCCTGTGTCTGCCCGATTGATGCTGCCGTAGCCAGCTTTCCTGAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGCATTTTTGCCATATCCACTATTTGGAGTCTGACCTCCCTAGGAAGCCTCCCTGCTCCCTAGGACAACCTGCTCTGACCTCTGAGG
>IGKV3-7*04_1/GTGGA/11_KDE__IGK+
CCCAGGCTCCTCATCTATGATGCATCCACCAGGGCCACTAGCATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAGCAGCCTGCAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGGATTATAACTTACCTCGTGGAGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGCATTTTTGCCATATCCACTATTTGGAGTCTGACCTCCCTAGGAAGCCTCCCTGCTCCCTAGGACAACCTGCTCTGACCTCTGAGG
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment