Commit 2b32c47d authored by Mikaël Salson's avatar Mikaël Salson

should-vdj-tests: A locus bug solved

parent 2e342bed
Pipeline #131059 passed with stages
in 154 minutes and 29 seconds
......@@ -156,7 +156,7 @@ AGCTCTGCTGATTTGTGGGCACTTATGAACCCGAAAGGACATGGCCATGGGGTGGGTAGGGACATAGGGACAGATGCCAG
CGCCCCACTTGATATTCCTTTTAGCCAGCTATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGCTATTAGTGGTAGTGGTGGTAGCACATACTACGCAGACTCCGTGAAGGGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTATATTACTGTGCGAAAGGGTGGGAGGTATTAAACTATGGTTCGGGGAGTTATTATAACGTTGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCCTCAGGTAACTC
#1347 vh2
>IGHV2-26*02 0/5/5 IGHD5-24*01 4/13/7 IGHJ4*02 [IGH] BUG-LOCUS
>IGHV2-26*02 0/5/5 IGHD5-24*01 4/13/7 IGHJ4*02 [IGH]
TCAGAGACCTCACGCTGACCTGCACCGTCTCTGGGTTCTCACTCAGCAATGCTAGAATGGGTGTGAGCTGGATCCGTCAGCCCCCAGGGAAGGCCCTGGAGTGGCTTGCACACATTTTTTCGAATGACAAAAAATCCTACAGCACATCTCTGAAGAGCAGGCTCACCATCTCCAAGGACACCTCCAAAAGCCAGGTGGTCCTTACCATGACCAATATGGACCCTGTGGACACAGCCACATATTACTGTGCATGGATACCCGAGGATGGCTACAACGACAAGAGCCAATGACTACTGGGGCCAGGGAACGCTGGTCACCGTCTCCTCAGGTAAATCCATGCACAGTAATATGTGGCTGTGTCCACAGGGTCCATATTGGTCATGGTAAGGACCACCTGGCTTTTGGAGGTGTCCTTGGAGA
#1339 vh3
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment