Commit 2b0f2474 authored by Mikaël Salson's avatar Mikaël Salson

should-vdj.org: minor typo

parent cf445cf4
......@@ -125,7 +125,7 @@ TGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGTT
* Running the tests
Vidjil can be tested on =.should-vdj= tests can be launched within the =algo/tests= directory:
Vidjil can be tested on =.should-vdj:= tests can be launched within the =algo/tests= directory:
- =python should-vdj-to-tap.py= runs one or several tests, given as parameters on the command line,
- =make shouldvdj= runs all =.should-vdj.fa= tests,
- =make shouldvdj_and_locus= further runs tests on the locus.
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment