should-vdj.org: minor typo

2b0f2474 · Mikaël Salson · cf445cf4 · 2b0f2474
Commit 2b0f2474 authored Oct 05, 2015 by Mikaël Salson
Hide whitespace changes
Inline Side-by-side

Showing with 1 addition and 1 deletion

doc/should-vdj.org doc/should-vdj.org +1 -1

No files found.
--- a/doc/should-vdj.org
+++ b/doc/should-vdj.org
@@ -125,7 +125,7 @@ TGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGTT

 * Running the tests

-Vidjil can be tested on =.should-vdj= tests can be launched within the =algo/tests= directory:
+Vidjil can be tested on =.should-vdj:= tests can be launched within the =algo/tests= directory:
  - =python should-vdj-to-tap.py= runs one or several tests, given as parameters on the command line,
  - =make shouldvdj= runs all =.should-vdj.fa= tests,
  - =make shouldvdj_and_locus= further runs tests on the locus.