Mise à jour terminée. Pour connaître les apports de la version 13.8.4 par rapport à notre ancienne version vous pouvez lire les "Release Notes" suivantes :
https://about.gitlab.com/releases/2021/02/11/security-release-gitlab-13-8-4-released/
https://about.gitlab.com/releases/2021/02/05/gitlab-13-8-3-released/

Commit 291a1eeb authored by Mathieu Giraud's avatar Mathieu Giraud

tests: faster tests

See #2254.
parent ba030105
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -t 0 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -FaW GAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACT $VIDJIL_DIR/data/Stanford_S22.fasta ; cat out/seq/clone.fa-1
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -x 2000 -t 0 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -FaW GAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACT $VIDJIL_DIR/data/Stanford_S22.fasta ; cat out/seq/clone.fa-1
$ Keep only one windows, the one given by -W, with only 5 reads (it is actually the second clone in Stanford_S22.fasta)
1: keep 1 windows in 5 reads
$ Keep only one windows, the one given by -W, with only 2 reads in the first 2000 reads (it is actually the second clone in Stanford_S22.fasta)
1: keep 1 windows in 2 reads
$ Tbere are the three IGHV/D/J genes in out/seq/clone.fa-1
3:>IGH
$ There are 5 reads in out/seq/clone.fa-1
5:>lcl
$ There are 2 reads in out/seq/clone.fa-1
2:>lcl
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -z 0 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -r 5 -W GAGAGATGGACGGGATACGTAAAACGACATATGGTTCGGGGTTTGGTGCT $VIDJIL_DIR/data/Stanford_S22.fasta ; cat out/Stanford_S22.vidjil
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -x 100 -z 0 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -r 5 -W ACTGTGCGAGAGTTGGAATTAGTAGTGGCTGGCCTGATTCCTGGGGCCAG $VIDJIL_DIR/data/Stanford_S22.fasta ; cat out/Stanford_S22.vidjil
$ Some clone has only one read, bypassing the -r 5 option, and the good label
1: clone-00..*0001-.* -W
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -z 0 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -r 5 -l $VIDJIL_DIR/data/Stanford_S22.label $VIDJIL_DIR/data/Stanford_S22.fasta ; cat out/Stanford_S22.vidjil
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -z 0 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -x 100 -r 5 -l $VIDJIL_DIR/data/Stanford_S22.label $VIDJIL_DIR/data/Stanford_S22.fasta ; cat out/Stanford_S22.vidjil
$ Some clone has only one read, bypassing the -r 5 option, and the good label
1: clone-00..*0001-.* my-clone
......
GAGAGATGGACGGGATACGTAAAACGACATATGGTTCGGGGTTTGGTGCT my-clone
ACTGTGCGAGAGTTGGAATTAGTAGTGGCTGGCCTGATTCCTGGGGCCAG my-clone
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment