Commit 27f797be authored by Mikaël Salson's avatar Mikaël Salson

should_get: Use format_json.py instead of format-json.sh

format_json.py raises an exception if the JSON is not valid.
Using format_json.py needs to slightly rewrite the test
(spaces are deleted, and the order may not be the same).
parent 07846306
!LAUNCH: ../../vidjil -G ../../germline/IGH -r 5 -b data ../../data/Stanford_S22.fasta ; cat out/data.vidjil | sh format-json.sh
!LAUNCH: ../../vidjil -G ../../germline/IGH -r 5 -b data ../../data/Stanford_S22.fasta ; cat out/data.vidjil | python ../../tools/format_json.py
$ Number of reads
1:"total" : [ 13153 ] ,
e1:"total": [13153],
$ Number of segmented reads
1:"segmented" : [ 13139 ]
e1:"segmented": [13139]
$ Most abundant window
1:"id" : "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC", "reads" : [ 8 ]
e1:"id": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC", "reads": [8]
!LAUNCH: ../../vidjil -G ../../germline/IGH ../../data/Stanford_S22.fasta ; python ../../tools/fuse.py out/Stanford_S22.vidjil out/Stanford_S22.vidjil -o out/fused.data ; cat out/fused.data | sh format-json.sh
!LAUNCH: ../../vidjil -G ../../germline/IGH ../../data/Stanford_S22.fasta ; python ../../tools/fuse.py out/Stanford_S22.vidjil out/Stanford_S22.vidjil -o out/fused.data ; cat out/fused.data | python ../../tools/format_json.py
$ Points list
1:"point": [ "", "" ]
$ Most abundant window, twice, fused
1:"id": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC", .*"reads": [ 8, 8 ]
1:"reads": \\[8, 8\\].*"id": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC"},.*"top": 2
# Fails since 49046ca6b97, no more 'others'
$ Windows that are not in the top 50
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment