Commit 2523c922 authored by marc's avatar marc Committed by Mathieu Giraud
Browse files

data/representative : replace representative fasta test files with fastQ

parent 125f5d41
>lcl|FLN1FA002QB069.1| @lcl|FLN1FA002QB069.1|
ggactggagtggattgggtatatctattacagtgggagcaccaactacaacccctccctcaagagtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgctgcggacacggccgtgtattactgtgcgagagggacatggtataacgacggctggcctcactttgactactggggcccgggaaccctggtcaccgtctcctcag ggactggagtggattgggtatatctattacagtgggagcaccaactacaacccctccctcaagagtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgctgcggacacggccgtgtattactgtgcgagagggacatggtataacgacggctggcctcactttgactactggggcccgggaaccctggtcaccgtctcctcag
cagtgggagcaccctttacaacccctccctcaagagtcgagtcaccatatcagaagacacgtccgagaaccagttctccctgaagctgagctctgtgaccgctgcggacacggccatatattactgtgcgagagggacatggtataacgacggctggcctcactttgactactggggcccgggaaccctggtcaccgtctcctcag cagtgggagcaccctttacaacccctccctcaagagtcgagtcaccatatcagaagacacgtccgagaaccagttctccctgaagctgagctctgtgaccgctgcggacacggccatatattactgtgcgagagggacatggtataacgacggctggcctcactttgactactggggcccgggaaccctggtcaccgtctcctcag
gcctggagtggattgggtacatctattacagtgggagcacctactacaacccgtccctcaagagtcgagttaccatatcagtagacacgtctaagaaccagttctccctgaagctgagctctgtgactgccgcggacacggccgtgtattactgtgcgagagggacatggtataacgacggctggcctcactttgactactggggcccgggaaccctggtcaccgtctcctcag gcctggagtggattgggtacatctattacagtgggagcacctactacaacccgtccctcaagagtcgagttaccatatcagtagacacgtctaagaaccagttctccctgaagctgagctctgtgactgccgcggacacggccgtgtattactgtgcgagagggacatggtataacgacggctggcctcactttgactactggggcccgggaaccctggtcaccgtctcctcag
cagtgggagcaccctttacaacccctccctcaagagtcgagtcaccatatcagaagacacgtccgagaaccagttctccctgaagctgagctctgtgaccgctgcggacacggccatatattactgtgcgagagggacatggtataacgacggctggcctcactttgactactggggcccgggaaccctggtcaccgtctcctcag cagtgggagcaccctttacaacccctccctcaagagtcgagtcaccatatcagaagacacgtccgagaaccagttctccctgaagctgagctctgtgaccgctgcggacacggccatatattactgtgcgagagggacatggtataacgacggctggcctcactttgactactggggcccgggaaccctggtcaccgtctcctcag
ggctggagtggattggggaaatcaatcatagtggaagcaccaactacaacccgtccctcaagagtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggctgtgtattactgtgcgagagggacatggtataacgacggctggcctcactttgactactggggcccgggaaccctggtcaccgtctcctcag ggctggagtggattggggaaatcaatcatagtggaagcaccaactacaacccgtccctcaagagtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggctgtgtattactgtgcgagagggacatggtataacgacggctggcctcactttgactactggggcccgggaaccctggtcaccgtctcctcag
Supports Markdown
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment