test: another test, stop codon after end of the J gene

algo/tests/data/productive_stop_after_J.fa

+
+# This synthetic sequence ends after the end of the J gene, 
+# including a stop codon in all frames in that zone
+
+# end of the J gene @90
+>TRGV9*01 0/CAT/0 TRGJP*01 0/17
+acctactactgtgccttgtgggaggtgCAT
+tgggcaagagttgggcaaaaaaatcaaggtatttggtcccggaacaaagcttatcattacag
+cccTAGcTAGcTAGccc

algo/tests/should-get-tests/productive_stop_after_J.should

+
+## Now a productive sequence, with a stop codon after a TRGJ gene
+## We now use -J ../TRGJ.fa, see #3147
+
+!LAUNCH: $VIDJIL_DIR/$EXEC -c designations -3 -V $VIDJIL_DIR/germline/homo-sapiens/TRGV.fa -J $VIDJIL_DIR/germline/homo-sapiens/TRGJ.fa $VIDJIL_DATA/productive_stop_after_J.fa
+!OUTPUT_FILE: out/productive_stop_after_J.vidjil
+
+$ Correct number of start positions (no V, but J, cdr3 and junction))
+3: "start"
+
+$ Correct stop position of TRGJP*01
+1: "stop": 92
+
+$ The sequence is productive
+f1: "productive": true
+