Attention une mise à jour du service Gitlab va être effectuée le mardi 30 novembre entre 17h30 et 18h00. Cette mise à jour va générer une interruption du service dont nous ne maîtrisons pas complètement la durée mais qui ne devrait pas excéder quelques minutes. Cette mise à jour intermédiaire en version 14.0.12 nous permettra de rapidement pouvoir mettre à votre disposition une version plus récente.

Commit 2250e6b2 authored by Mikaël Salson's avatar Mikaël Salson
Browse files

10-germlines-IGH-upstream.should-get: Update test

Use awk rather than awk to output the sequence. With grep we need to know on
how many lines the gene is, while it is not necessary with awk (albeit somehow
more complicated).
parent 80210569
!NO_LAUNCHER:
!LAUNCH: (cd $VIDJIL_DIR/germline ; grep -A2 -F 'IGHD2-2*02' homo-sapiens/IGHD+up.fa | tr -d '\n')
# The awk part prints the IGHD2-2*02 sequence
!LAUNCH: (cd $VIDJIL_DIR/germline ; awk '$0 ~ /IGHD2-2.02/ {print; getline; while ($0 !~ /^>/) {print; getline}}' homo-sapiens/IGHD+up.fa | tr -d '\n')
$ Correct sequence, with upstream
i1:AGGATTTTGTGGGGGCTCGTGTCACTGTGA
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment