Commit 1f442175 authored by flothoni's avatar flothoni Committed by Mathieu Giraud

model.js; Add primer sequences of ecngs publication

primer 3 sequence is given in reverse complement
parent b06a678c
......@@ -3074,7 +3074,8 @@ changeAlleleNotation: function(alleleNotation, update, save) {
* TODO : Give the posibility to user to load his own primer set
*/
populatePrimerSet : function () {
this.primersSetData = {"biomed2" : {}, "primer_fictif": {}, "primer_test": {} }
console.log("Model; populatePrimerSet()")
this.primersSetData = {"biomed2" : {}, "primer_fictif": {}, "primer_test": {}, "ecngs": {}, "ecngs_FR1": {} }
// Seq de primer biomed2 des TCRD
......@@ -3085,7 +3086,42 @@ changeAlleleNotation: function(alleleNotation, update, save) {
this.primersSetData.biomed2.IGH = {}; // TODO : init by defaultdict equivalent
this.primersSetData.biomed2.IGH.primer5 = ["GGCCTCAGTGAAGGTCTCCTGCAAG", "GTCTGGTCCTACGCTGGTGAAACCC", "CTGGGGGGTCCCTGAGACTCTCCTG", "CTTCGGAGACCCTGTCCCTCACCTG", "CGGGGAGTCTCTGAAGATCTCCTGC", "TCGCAGACCCTCTCACTCACCTGTG", "CTGGGTGCGACAGGCCCCTGGACAA", "TGGATCCGTCAGCCCCCAGGGAAGG", "GGTCCGCCAGGCTCCAGGGAA", "TGGATCCGCCAGCCCCCAGGGAAGG", "GGGTGCGCCAGATGCCCGGGAAAGG", "TGGATCAGGCAGTCCCCATCGAGAG", "TTGGGTGCGACAGGCCCCTGGACAA", "TGGAGCTGAGCAGCCTGAGATCTGA", "CAATGACCAACATGGACCCTGTGGA", "TCTGCAAATGAACAGCCTGAGAGCC", "GAGCTCTGTGACCGCCGCGGACACG", "CAGCACCGCCTACCTGCAGTGGAGC", "GTTCTCCCTGCAGCTGAACTCTGTG", "CAGCACGGCATATCTGCAGATCAG"] ;
this.primersSetData.biomed2.IGH.primer3 = ["CCAGTGGCAGAGGAGTCCATTC", "GTCACCGTCTCCTCAGGTA"]; // GTCACCGTCTCCTCAGGTA is a consensus sequence use because official one (CCAGTGGCAGAGGAGTCCATTC) doesn't work properly
// GGTCACCGTCTCCTCAGGTGAG
// Primer ECNGS, can include degenerated sequences
this.primersSetData.ecngs.IGH = {};
this.primersSetData.ecngs.IGH.primer5 = ["CTGGGTGCGACAGGCCCCT", "CAGGCTCCTGGAAAAGGGCTTGA", "CCCCCGGACAAAGGCTTGA", "CCCGGACAAGCGCTTGAG", "CGACAGGCTCGTGGACAAC", "CGTCAGCCCCCAGGAAAGG", "CCGCCAGGCTCCAGGGAA", "ATGCACTGGGTCCGCCAAG", "CCAGGCTCCAGGAAAGGG", "GCCAGGCTCCCGGGAAGG", "CAGGCTCCAGGCAAGGGG", "ATGCACTGGGTCCGTCAAGC", "GCACTGGGTCTGCCAGGCTC", "CCAGGCTTCCGGGAAAGGG", "ATGCACTGGGTCCGGCAAG", "GGCAGCCCCCAGGGAAGG", "GCCAGCACCCAGGGAAGG", "CAGCCACCAGGGAAGGGCC", "AACTGGGTGCGACAGGCCAC", "CTGGGTGCGCCAGATGCC", "GAACTGGATCAGGCAGTCCC", "GGTTAGATCTGTCAGCCCTCAG", "ATGAGCTGGGTCCGCCAAG", "CTGGGTCCGCCAAGCTACAGGAAA", "GGTCCGCCAGGCTCCAGGGAA", "GGTCCGCCAAGCTCCAGGGAA", "TCCGCCAGCCCCCAGGGAAGG"]
this.primersSetData.ecngs.IGH.primer5.concat(["GATTCYGAACAGCCCCGAGTCA", "GATTTTGTGGGGGYTCGTGTC", "GTTTGRRGTGAGGTCTGTGTCA", "GTTTRGRRTGAGGTCTGTGTCACT", "CTTTTTGTGAAGGSCCCTCCTR", "GTTATTGTCAGGSGRTGTCAGAC", "GTTATTGTCAGGGGGTGYCAGRC", "GTTTCTGAAGSTGTCTGTRTCAC"])
this.primersSetData.ecngs.IGH.primer3 = ["GGTCACCGTCTCCTCAGGTAAG", "GGTCACCGTCTCCTCAGGTGAG"] // complement
this.primersSetData.ecngs.IGKDE = {};
this.primersSetData.ecngs.IGK_DE = ["GCAGCTGCAGACTCATGAGGAG"]
this.primersSetData.ecngs.IGK_INTR = ["GAGTGGCTTTGGTGGCCATGC"]
this.primersSetData.ecngs.IGK = {};
this.primersSetData.ecngs.IGK.primer5 = ["AAGTGGGGTCCCATCAAGGTTCAG", "AGTCCCATCTCGGTTCAGTGGCAG", "GAAACAGGGGTCCCATCAAGGTTC", "TCCCAGACAGATTCAGTGGCAGTG", "CTGGAGTGCCAGATAGGTTCAGTG", "CCCTGGAGTCCCAGACAGGTTCAG", "GCATCCCAGCCAGGTTCAGTG", "GTCCCTGACCGATTCAGTGGCA", "AATCCCACCTCGATTCAGTGGC", "CTCAGGGGTCCCCTCGAGGTT", "AGACACTGGGGTCCCAGCCA"]
this.primersSetData.ecngs.IGK.primer3 = ["GGGACCAAGGTGGAGATCAAACGT", "GGGACCAAAGTGGATATCAAACGT", "GGGACACGACTGGAGATTAAACGT"] // complement
this.primersSetData.ecngs.TRB = {};
this.primersSetData.ecngs.TRB.primer5 = ["CTCAGTTGAAAGGCCTGATGGA", "TCAGCTAAGTGCCTCCCAAATT", "GCCAAAGGAACGATTTTCTGCT", "CTGAAGGGTACAGCGTCTCTC", "TTTCTCATCAACCATGCAAGCC", "TGAGCGATTTTTAGCCCAATGC", "GGAGATGCACAAGAAGCGATTC", "ACAAAGGAGAGATCTCTGATGGA", "TCCTCTGAGTCAACAGTCTCCA", "AGGGAGATGTTCCTGAAGGGTA", "CCTGAGGGGTACAGTGTCTCTA", "CTGAGGCCACATATGAGAGTGG", "CAGAATCTCTCAGCCTCCAGAC", "AGTTCCAAATCGCTTCTCACCT", "TCGCTTCTCACCTGAATGCCC", "GGAAACTTCCCTGGTCGATTC", "ACTTCCCTGATCGATTCTCAGC", "TTCCCTAATCGATTCTCAGGGC", "GATTCTCAGGTCTCCAGTTCCC", "CTCAGGTCACCAGTTCCCTAAC", "CCTAGATTTTCAGGTCGCCAGT", "TACAACTGCCAAAGGAGAGGTC", "TACCACTGGCAAAGGAGAAGTC", "TAAAGGAGAAGTCCCGAATGGC", "GGAGAAGTTCCCAATGGCTACA", "CAACGATCGGTTCTTTGCAGTC", "TAAATCAGGGCTGCTCAGTGAT", "CAGTGATCGGTTCTCTGCAGAG", "CTCAACTAGACAAATCGGGGCT", "CTTGAACGATTCTCCGCACAAC", "ATAAAGGAGAAGTCCCCGATGG", "CAAAGGAGAAGTCTCAGATGGC", "ATCGATTTTCTGCAGAGAGGCT", "CCGAGGATCGATTCTCAGCTAA", "CTCTAGATGATTCGGGGATGCC", "GGAAGCATCCCTGATCGATTCT", "CGGTATGCCCAACAATCGATTC", "TGAAGCAGACACCCCTGATAAC"]
this.primersSetData.ecngs.TRB.primer5.concat(["CCTCCACTCCCCTCAAAGGA", "CAGACTAACCTCTGCCACCTG"])
this.primersSetData.ecngs.TRB.primer3 = ["GGCACCAGACTCACAGTTGTAG", "GGACCAGGTTAACCGTTGTAG", "GGACCAGGTTAACCGTTGTAG", "GGGAAGTTGGCTCACTGTTGTA", "GGGAAGTTGGCTCACTGTTGTA", "GGAACCCAGCTCTCTGTCTTG", "GGAACCCAGCTCTCTGTCTTG", "GGGACTCGACTCTCCATCCTAG", "GGGACTCGACTCTCCATCCTAG", "GACCAGGCTCACTGTGACAG", "GACCAGGCTCACTGTGACAG", "CTCACCGTGCTAGGTAAGAAGG", "CTCACCGTGCTAGGTAAGAAGG", "CTAGGCTGACCGTACTGGGTAA", "CTAGGCTGACCGTACTGGGTAA", "GGCTGACAGTGCTCGGTAAG", "GGCTGACAGTGCTCGGTAAG", "GGCTCTCAGTGCTGGGTAAG", "GGCTCTCAGTGCTGGGTAAG", "GGCTCCTGGTGCTCGGTGA", "GGCTCCTGGTGCTCGGTGA", "GACCGTGCTGGGTGAGTTTTC", "GACCGTGCTGGGTGAGTTTTC", "GGCTGACCGTGCTGGGTGA", "GGCTGACCGTGCTGGGTGA", "CTCACGGTCACAGGTGAGATTC", "CTCACGGTCACAGGTGAGATTC"] // complement
this.primersSetData.ecngs.TRD = {};
this.primersSetData.ecngs.TRD.primer5 = ["GAATGCAAAAAGTGGTCGCTATTC", "TGCAAAGAACCTGGCTGTACT", "TGCAGATTTTACTCAAGGACGG", "GCAAAATGCAACAGAAGGTCG","GATAAAAATGAAGATGGAAGATTCACTGT", "CTCCTTCAATAAAAGTGCCAAGC", "ATTGAAAAGAAGTCAGGAAGACTAAGT", "TCCAGAAAGCAGCCAAATCC"]
this.primersSetData.ecngs.TRD.primer5.concat(["AGGGGTATTGTGGATGGCAG", "CCCAGGGAAATGGCACTTTTG"])
this.primersSetData.ecngs.TRD.primer3 = ["ACCCGTGTGACTGTGGAA", "AACACAACTCATCGTGGAACC", "ACTGGCATCAAACTCTTCGTG", "AACCTATCTGGAGGTACAACAAC", "TGCAAGTAAGTGTTTCTAGCCA"] // complement
this.primersSetData.ecngs.TRG = {};
this.primersSetData.ecngs.TRG.primer5 = ["GCACAAGGAACAACTTGAGATTG", "TGGAAGCACAAGGAAGAACTTGAGAA", "GCACAGGGAAGAGCCTTAAATT", "CAGGAGGTGGAGCTGGATATT", "CAAGCATGAGGAGGAGCTGGAAATTG", "ACGTCTACATCCACTCTCACC", "CTCTCACTTCAATCCTTACCATCAA", "GCTCACACTTCCACTTCCACTTTGAAAATAAAGT"]
this.primersSetData.ecngs.TRG.primer3 = ["CTTTGGCAGTGGAACAACACT", "CAAGGTATTTGGTCCCGGAAC", "TATTTGCTGAAGGGACTAAGCTC", "CGTTTGCAAAAGGGACTAGG"] // complement
// IGH FR1
this.primersSetData.ecngs_FR1.IGH = {}
this.primersSetData.ecngs_FR1.IGH.primer5 = ["CTGGGGCTGAGGTGAAGAAG", "GCAGTCTGGAGCAGAGGTGAAAA", "TCACCTTGAAGGAGTCTGGTCC", "AGGTGCAGCTGGTGGAGTC", "GAGGTGCAGCTGTTGGAGTC", "CCAGGACTGGTGAAGCCTTC", "CAGTGGGGCGCAGGACTGTT", "CCAGGACTGGTGAAGCCTCC", "GTACAGCTGCAGCAGTCAGG", "GCTGGTGCAATCTGGGTCTG", "CCTCAGTGAAGGTTTCCTGCAAGG", "AAACCCACAGAGACCCTCACGCTGAC", "CTGGGGGGTCCCTGAGACTCTCCTG", "CTTCACAGACCCTGTCCCTCACCTG", "TCGCAGACCCTCTCACTCACCTGTG"]
this.primersSetData.ecngs_FR1.IGH.primer5.concat(["GATTCYGAACAGCCCCGAGTCA", "GATTTTGTGGGGGYTCGTGTC", "GTTTGRRGTGAGGTCTGTGTCA", "GTTTRGRRTGAGGTCTGTGTCACT", "CTTTTTGTGAAGGSCCCTCCTR", "GTTATTGTCAGGSGRTGTCAGAC", "GTTATTGTCAGGGGGTGYCAGRC", "GTTTCTGAAGSTGTCTGTRTCAC"])
this.primersSetData.ecngs_FR1.IGH.primer3 = ["GGTCACCGTCTCCTCAGGTAAG", "GGTCACCGTCTCCTCAGGTGAG"] // complement
// test fictif; sequence inclut dans les sequences de clones
this.primersSetData.primer_fictif.TRD = {};
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment