Commit 1f294dbc authored by Mathieu Giraud's avatar Mathieu Giraud

tests: typo

parent 10b843ca
>Intron -5/CGCCA/-4 KDE [IGK+]
>Intron 5/CGCCA/4 KDE [IGK+]
CGTGGCACCGCGAGCTGTAGACAGAGCCGCGGTCTTTCTCGATTGAGTGGCTTTGGTGGCCATGCCACCGCGCTCTTGGGGCAGCCGCCTTGCCGCTAGTGGCCGTGGCCACCCTGTGTCTGCCCGATTAATGCTGCCGTAGCCAGCTTTCCCGCCACCCTAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGCATTTTTGCCATATCCACTATTTGGAGTCTGACCTCCCTAGGAAGCCTCCCTGCTCCCTAGGACAACCTGCTCTGACCTCTGAGG
\ No newline at end of file
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment