Commit 1f12079d authored by Mathieu Giraud's avatar Mathieu Giraud

tests: one sequence from Stanford-S22, with his reverse complement

As noted by @mikael-s, e963e165 hided a failed test in vidjil_revcomp_s22.should_get.
This test is one challenging sequence from Stanford-S22:
we currently do not find the same window on the sequence and on its revcomp.
parent 6f4bdfbc
!LAUNCH: $LAUNCHER ../../vidjil -k 9 -G ../../germline/IGH -K -c clones ../../data/revcomp.fa
$ Segments both reads, normal and revers
1:segmented 2 reads
$ Only one window
f1:==> found 1 60-window
>lcl|FLN1FA002SHKLI.1|Stanford-S22
GACTGGAGTGGATTGGGTATATCTATTACAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTACTGTGCGAGAGATGAGGGGTTCGGGGAGTTATTATTTTATCCGGCCCTGAACTTCGCCGCCTGACCTCAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG
>lcl|FLN1FA002SHKLI.1|Stanford-S22|revcomp
CTGAGGAGACGGTGACCAGGGTTCCCTGGCCCCAGGGGTCGAACCAGTTGAGGTCAGGCGGCGAAGTTCAGGGCCGGATAAAATAATAACTCCCCGAACCCCTCATCTCTCGCACAGTAATACACGGCCGTGTCCGCAGCGGTCACAGAGCTCAGCTTCAGGGAGAACTGGTTCTTGGACGTGTCTACTGATATGGTGACTCGACTCTTGAGGGAGGGGTTGTAGTTGGTGCTCCCACTGTAATAGATATACCCAATCCACTCCAGTC
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment