Commit 1ecb80c1 authored by Mathieu Giraud's avatar Mathieu Giraud

should-get-tests/segmentation-D-read-number.should-get: no $ starting a line

parent 31511ddb
......@@ -6,9 +6,9 @@
# other reads. This is what is tested, we first put 10 sequences, then 5 and
# finally just the sequence of interest alone.
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -d -r 1 -w 60 -z 100 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/buggy-D.fa; \
$VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -d -r 1 -w 60 -z 100 -x 6 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/buggy-D.fa;\
$VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -d -r 1 -w 60 -z 100 -x 1 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/buggy-D.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -d -r 1 -w 60 -z 100 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/buggy-D.fa \
; $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -d -r 1 -w 60 -z 100 -x 6 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/buggy-D.fa \
; $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -d -r 1 -w 60 -z 100 -x 1 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/buggy-D.fa
$ Three times the same window
3: TGTGCGGGATCTTCGTCCTCTTATCATAATAATGGTTTTTTGGCGGGGGAGTCATGGGGC
......
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment