Commit 1d792438 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: new tests, --filter-reads

see #4681
parent f3c49d56
# Random DNA sequences, %GC = 0.50
>random-10
tgtcccgatt
>random-20
aatggatgtaccggaggctg
>random-30
gcaactgcgatgagggtacccccccactct
>random-40
gcaaccgtgtggtggtgcagcatgtaatgtctaacccgtc
>random-50
gcaacgtccggttggtaagccggaaaaagtaaacctgtatgcgctacatg
>random-60
ccaatctttagtgactcctgtctcgtggcaagctgtccgttttgggcgtaggttccagaa
>random-70
aggtagggtttgtaggtatgactggctcaacgtgataggccgagagcaagttcattgacaacaccctctg
>random-80
gaaaaggcccacgccggcagctgtgagatgttaggtccggggggtcgctagtattctcacacctgcataacccgggaata
>random-90
ggcaagactaacctatggttccgtgtaagcaacccttcccaaaccgatctctcgccgagcccaccagtaaccccttaagacaaacctggt
>random-100
atttgtatgtctggccacctaaagctacaataagccggatgatagtcagatcgcaaatagcgtttatccggctttaaacgcggaacgcgtgagtattttg
!NO_LAUNCHER:
!LAUNCH: cat $VIDJIL_DATA/random.fa $VIDJIL_DATA/segment_S22.fa > $VIDJIL_DATA/random+S22.fa
!LAUNCH: $VIDJIL_DIR/$EXEC --filter-reads -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/random+S22.fa
$ Correct information
1: Detecting V.D.J recombinations
$ Correct filtering
1: junction detected in 3 reads .23..%.
1: IGH .* 3
$ Output
1: ==> .*/random.S22.detected.vdj.fa
$ No spurious output (implied -c detect)
3:windows
0:Diversity measures
0:AIRR output
\ No newline at end of file
!NO_LAUNCHER:
cd $VIDJIL_DIR ; ./$EXEC -h | grep '$EXEC -c' | sed 's/X 50/X 5/' | sed 's/demo.LIL-L4/-X 1000 demo\/LIL-L4/' > help-examples.sh
cd $VIDJIL_DIR ; ./$EXEC -h | grep '$EXEC.*\#' | sed 's/X 50/X 5/' | sed 's/demo.LIL-L4/-X 1000 demo\/LIL-L4/' > help-examples.sh
cd $VIDJIL_DIR ; sh help-examples.sh
# Test examples embedded in './vidjil-algo -h'
# Run 6 times (-h + 5 examples)
6:vidjil-algo -- V.D.J recombinations analysis
# Run 7 times (-h + 6 examples)
7:vidjil-algo -- V.D.J recombinations analysis
# '-c clone', three times
3: end of clones
# '--filter-reads'
1:Detecting
# '-c windows'
1:Extracting windows
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment