Une MAJ de sécurité est nécessaire sur notre version actuelle. Elle sera effectuée lundi 02/08 entre 12h30 et 13h. L'interruption de service devrait durer quelques minutes (probablement moins de 5 minutes).

Commit 1915e503 authored by Mikaël Salson's avatar Mikaël Salson Committed by Mathieu Giraud
Browse files

should-get/no_representative: Longer representative with new computation

With the new algorithm the representative now spans the whole reads with Ns
denoting the ambiguities.
parent 6a525d59
......@@ -4,7 +4,10 @@ $ Short reads properly segmented
1:SEG_+.* -> .* 4
$ Window found
2:^CACCCCCCCCCTTTTTTTCT$
1:^CACCCCCCCCCTTTTTTTCT$
$ Representative computation
1:>clone-001--custom--0000004--100%--seq.-\\[11,30\\]
1:>clone-001--custom--0000004--100%--seq.-\\[0,41\\]
$ Representative sequence
1: TATATGTATANCACCCCCCCCCTTTTTTTCTNGCGCGAGCGA
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment