Commit 184c6049 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: tests overlap and stdout

In some cases, some bases are missing from stdout.
Thanks to F. Levander for this bug report.
parent f5da8786
!LAUNCH: ../../vidjil -c segment -G ../../germline/IGH -A ../../data/overlap-d-j.fa | tail -4 | tr '\\\\n' '!' | sed 's/!//g' | wc
$ Exported sequence has all the bases
1:116
# Some overlap between end of D and start of J
>IGHV1-18*01--IGHD1-1*01--IGHJ1*01
atggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagaga
ggtacaactggaacg
ac
ttccagcactggggccagggcaccctggtcaccgtctcctcag
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment