Une MAJ de sécurité est nécessaire sur notre version actuelle. Elle sera effectuée lundi 02/08 entre 12h30 et 13h. L'interruption de service devrait durer quelques minutes (probablement moins de 5 minutes).

Commit 14847dd7 authored by Mikaël Salson's avatar Mikaël Salson Committed by Mathieu Giraud
Browse files

gosh-igh: typo

Deletion in 5'J is 5 instead of 6.
parent 5522ae2f
...@@ -107,7 +107,13 @@ CGGCAGTCTCCTGCAGGCTTCTGGATTCACCTTTACTAGCTCTGCTATGCAGTGGGTGCGACAGGCTCGTGGACAACGCC ...@@ -107,7 +107,13 @@ CGGCAGTCTCCTGCAGGCTTCTGGATTCACCTTTACTAGCTCTGCTATGCAGTGGGTGCGACAGGCTCGTGGACAACGCC
AAACAGACCCTCACGCTGACCTGCACCTTCTCTGGGTTCTCACTCAGCACTAGTGGAGTGGGTGTGGGCTGGATCCGTCAGCCCCCAGGAAAGGCCCTGGAGTGGCTTGCACTCATTTATTGGGATGATGATAAGCGCTACAGCCCATCTCTGAAGAGCAGGCTCACCATCACCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAACATGGACCCTGTGGACACAGCCACATATTACTGTGCACACCGGCCCCGGGTAGTACCAGCTGCTATACCCTTAATATTACTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAG AAACAGACCCTCACGCTGACCTGCACCTTCTCTGGGTTCTCACTCAGCACTAGTGGAGTGGGTGTGGGCTGGATCCGTCAGCCCCCAGGAAAGGCCCTGGAGTGGCTTGCACTCATTTATTGGGATGATGATAAGCGCTACAGCCCATCTCTGAAGAGCAGGCTCACCATCACCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAACATGGACCCTGTGGACACAGCCACATATTACTGTGCACACCGGCCCCGGGTAGTACCAGCTGCTATACCCTTAATATTACTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAG
#1400 vh3 #1400 vh3
>IGHV3-53*01 0/8/2 IGHD3-10*01 5/0/6 IGHJ4*02 [IGH] # sequence: GTGTATTACTGTGCGAGAGATAAAAGGGATTACTATGGTTCAGGGAGTTATTTTTGACTA
# |||||||||||||||||||| ||||||||||||| ||||||||||
# IGHV3-53*01: GTGTATTACTGTGCGAGAGA
# IGHD3-10*01: GTATTACTATGGTTCGGGGAGTTATTATAAC
# |||||||
# IGHJ4*02: ACTACTTTGACTACTGGGGCCAGGGAACCCTGG
>IGHV3-53*01 0/8/2 IGHD3-10*01 5/0/5 IGHJ4*02 [IGH]
GGGGCTCGTCAGTAGCACTACATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGTTATTTATAGCGGTGGTAGCACATACTACGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCGAGAGATAAAAGGGATTACTATGGTTCAGGGAGTTATTTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGG GGGGCTCGTCAGTAGCACTACATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGTTATTTATAGCGGTGGTAGCACATACTACGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCGAGAGATAAAAGGGATTACTATGGTTCAGGGAGTTATTTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGG
#1387 vh3 #1387 vh3
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment