Commit 134813c0 authored by Mathieu Giraud's avatar Mathieu Giraud
Browse files

tests: an actual no-WPGxG-pattern sequence

close #4701
parent 8f3d815f
Pipeline #234981 passed with stages
in 48 minutes and 16 seconds
......@@ -30,3 +30,10 @@ AATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAG
CGATCCCCCGGTATTACTATGATACTAGTGGCCCAAAC
GACTACTGGGaCCAGGGAACCCTGGTCACCGTCTCCTCAG
# No {WP}GxG pattern
>lil-42854-0
GGAGTCGGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCGTCTGGATTCACCTTCAGTGACTATGGCATGCACTGGGTCCGCCAGGTTCCAGGCAAGGGGCTGGAGTGGGTGGCAATTATTTCATATGATGGAAATAATAAGTACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACCTTTCCAGGAAGACACTATATTTACAAATGAACAACCTCAGAGTCGAGGACACGGCTGTCTATTACTGTGCGAGAG
GAATAGTGGGAACTACCGACGCAACA
TTTGACTACTGGGCCAGGGAGTTCTGGTCACCGTCTCCTCAGG
TAAG
......@@ -7,17 +7,21 @@ $ Two identical TRG junctions, and one with a spurious nucleotide
:clones[1].seg.junction.aa: CATWDRKNYYKKLF
:clones[2].seg.junction.aa: CATWDRK#NYYKKLF
$ Two identical IGH junctions
$ Two identical IGH junctions, and another one
:clones[4].seg.junction.aa: CARAIPRYYYDTSGPNDYW
:clones[5].seg.junction.aa: CARAIPRYYYDTSGPNDYW
:clones[6].seg.junction.aa: CARGIVGTTDATFDYW
$ But only one TRG and one IGH productive
$ But only one TRG productive
:clones[0].seg.junction.productive: False
:clones[1].seg.junction.productive: True
:clones[2].seg.junction.productive: False
:clones[3].seg.junction.productive: False
$ and only one IGH productive
:clones[4].seg.junction.productive: True
:clones[5].seg.junction.productive: False
:clones[6].seg.junction.productive: False
$ Cause of unproductivity
:clones[0].seg.junction.unproductive: stop-codon
......@@ -26,6 +30,7 @@ $ Cause of unproductivity
:clones[3].seg.junction.unproductive: too-short
0:clones[4].seg.junction.unproductive
:clones[5].seg.junction.unproductive: no-WPGxG-pattern
:clones[6].seg.junction.unproductive: no-WPGxG-pattern
!OUTPUT_FILE: out/productive_stop_outframe.tsv
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment