Commit 1253a4f8 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: MAX12 germline, testing '-2' option

parent 9a4f23cb
!LAUNCH: ../../vidjil -t 0 -g ../../germline -2 -i ../../data/chimera-fake.fa
!LAUNCH: ../../vidjil -A -t 0 -g ../../germline -2 -i ../../data/chimera-fake.fa
$ Segment all reads
1:junction detected in 3 reads
$ Segment all reads on 'xxx'
$ The KmerSegmenter segments the three chimera reads on PSEUDO_MAX12 germline (-2)
1:xxx .* -> .* 3
$ The FineSegmenter gives the locus information (-2)
1:Unexpected .A-TRAV/.B-TRBV
1:Unexpected .G-TRGV/.D-TRDV
1:Unexpected .H-IGHV/.K-IGKV
!LAUNCH: ../../vidjil -A -g ../../germline -i -2 ../../data/chimera-fake-VJ.fa
$ The KmerSegmenter segments the three chimera reads on PSEUDO_MAX12 germline (-2)
1:xxx .* -> .* 3
$ The FineSegmenter gives the locus information (-2)
1:Unexpected .K-IGKV/.l-IGLJ
1:Unexpected .B-TRBV/.g-TRGJ
1:Unexpected .D-TRDV/.h-IGHJ
# Fake chimera sequences, (somewhat unprobable) V-J recombinations
>TRBV1*01--TRGJ1*01
cagcaagaagactcagctgcgtatctctgcaccagcagccaaga
gaattattataagaaactctttggcagtggaacaacactggttgtcacag
>TRDV1*01--IGHJ1*01
ttacagctagaagattcagcaaagtacttttgtgctcttggggaact
gctgaatacttccagcactggggccagggcaccctggtcaccgtctcctcag
>IGKV1-12*01--IGKJ1*01
gaagattttgcaacttactattgtcaacaggctaacagtttccctcc
ttatgtcttcggaactgggaccaaggtcaccgtcctag
# Fake chimera sequences, 2 x (first 60 bp) of some V genes
>TRAV1-1*01--TRB--V1*01
>TRAV1-1*01--TRBV1*01
ggacaaagccttgagcagccctctgaagtgacagctgtggaaggagccattgtccagata
gatactggaattacccagacaccaaaatacctggtcacagcaatggggagtaaaaggaca
......
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment