Une MAJ de sécurité est nécessaire sur notre version actuelle. Elle sera effectuée lundi 02/08 entre 12h30 et 13h. L'interruption de service devrait durer quelques minutes (probablement moins de 5 minutes).

Commit 1222b162 authored by Mikaël Salson's avatar Mikaël Salson Committed by Mathieu Giraud
Browse files

gosh-igh: two possibilities

Whether you consider the mutation as being part of the V or not, you
have two possibilities.
parent 84f2acae
......@@ -39,7 +39,12 @@ CGGGGTAGGTCTCTGCAGGCTTCTGGAGGCACCTTCAGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGG
CTCCTGTGCATCTCCGGGGACAGTGTCTCTAGCAACAGTGCTGCTTGGAACTGGATCAGGCAGTCCCCATCGAGAGGCCTTGAGTGGCTGGGAAGGACATACTACAGGTCCAAGTGGTATAATGATTATGCAGTATCTGTGAAAAGTCGAATAACCATCAACCCAGACACATCCAAGAACCAGTTCTCCCTGCAGCTGAACTCTGTGACTCCCGAGGACACGGCTGTGTATTACTGTGCAACGGGGGGTTCTGCGGGATATTGTAGTAGTACCAGCTGTCCCTCGGACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGT
#1465 dh3
>IGHD3-3*01 19/8/31 IGHJ6*02 [IGH+]
#sequence: TGGTATTACGATTTTCGGAGCCAGGGCCAAGGGACCACGGTCACCGTCTCCGCA
# ||||||||||||||| ||||
#IGHD3-3: TGGTATTACGATTTTTGGAGTGGTTATTATACC
# |||||||||||||||||||||||||||||||
#IGHJ6*02: ATTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCA
>IGHD3-3*01 (13/3, 18/8)/31 IGHJ6*02 [IGH+] BUG
TCTGGCGTGATTTGGGGGGCAATTTATAAACCCAAAAGGACATGGCCATGCAGCGGGTAGGGACAATACAGACACGATATCAGCCTGAAATGGAGCCTCAGGGCACAGGTGGGCACGGACACTGTCCACCTAAGCCAGGGGCAGACCCGAGTGTCCCCGCAGTAGACCTGAGAGCGCTGGGCCCACAGCCTCCCCTCGGTGCCCTGCTACCTCCTCAGGTCAGCCCTGGACATCCCGGGTTTCCCCAGGCCTGGCGGTAGGTTTGGGGTGAGGTCTGTGTCACTGTGGTATTACGATTTTCGGAGCCAGGGCCAAGGGACCACGGTCACCGTCTCCGCAGGTAACC
#1463 vh3
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment