Commit 11f3d530 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: json output, check also JUNCTION and CDR3 information

parent 32aaa23d
......@@ -136,6 +136,7 @@ protected:
string sequence;
string sequence_or_rc;
// JUNCTIONstart/end and CDR3start/end are 1-based
int JUNCTIONstart, JUNCTIONend;
string JUNCTIONaa;
bool JUNCTIONproductive;
......
!REQUIRES: python $VIDJIL_DIR/tools/check_python_version.py
!LAUNCH: $VIDJIL_DIR/vidjil -z 1 -G $VIDJIL_DIR/germline/IGH -w 60 -r 5 -e 10 -b data $VIDJIL_DIR/data/Stanford_S22.fasta > /dev/null ; cat out/data.vidjil | python $VIDJIL_DIR/tools/format_json.py -1
!LAUNCH: $VIDJIL_DIR/vidjil -3 -z 1 -G $VIDJIL_DIR/germline/IGH -w 60 -r 5 -e 10 -b data $VIDJIL_DIR/data/Stanford_S22.fasta > /dev/null ; cat out/data.vidjil | python $VIDJIL_DIR/tools/format_json.py -1
$ Number of reads
e1:"total": [13153]
......@@ -16,7 +16,8 @@ $ Affect values are over all the sequence
$ Segmentation
1:"name": "IGHV3-23.05 6/ACCCGGGAGGAACAATAT/9 IGHD6-13.01 0//5 IGHJ4.02"
# 1 2 3 4 5 * 6 7 * 8 ** 9 10 11 12
# Cys-T-=R=-E-=E=-Q-=Y=-S-=S=-W-=Y=-F-=D=-F-Trp
# 1 2 3 4 5 | *| 6 7 * 8 ** 9 | |10 11 12
# 12345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678
# 5-----------------------------------------------------5N----------------ND----------DJ-----------------------------------------J
# GCTGTACCTGCAAATGAACAGCCTGCGAGCCGAGGACACGGCCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCCAGGGGATCCTGGTCACCGTCTCCTCAG
......@@ -25,6 +26,8 @@ $ Segmentation
# 5(V): 1 -> 55
# 4(D): 74 -> 85
# 3(J): 86 -> 128
# CDR3: 56 -> 94
# JUNCTION: 53 -> 97
$ Segmentation details - V
1:"5": ."delRight": 6, "end": 55, "name": "IGHV3-23.05".
......@@ -39,6 +42,10 @@ $ Segmentation details - N1, N2
1:"N1": 18,
1:"N2": 0,
$ Segmentation details - CDR3, JUNCTION
1:"cdr3": ."aa": "TREEQYSSWYFDF", "start": 56, "stop": 94.
1:"junction": ."aa": "CTREEQYSSWYFDFW", .* "start": 53, "stop": 97.
$ Second sequence has a DNA sequence provided
1:"id": "CTGTGCGAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACTACTA".*"sequence": "[ACGT]+",
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment