Commit 118645eb authored by Mikaël Salson's avatar Mikaël Salson

7849-deleted-J.should-vdj.fa: Buggy sequence from #3008

The junction is given neither by IgBlast nor by IMGT (the latter correctly
finds the V/J genes though).
parent 757185a9
# TRGV3*01 TGCCACCTGGGACAGG
# |||||||||||||
# seq TGCCACCTGGGACTCTTCTGTTGTCACAGGTAAGTATC
# ||||||||||||||||||||
# TRGJ2*01 GAATTATTATAAGAAACTCTTTGGCAGTGGAACAACACTTGTTGTCACAGGTAAGTATC
>TRGV3*01 3/TCTTC/39 TRGJ2*01
CTACACCAGGAGGGGAAGGCCCCACAGCGTCTTCTGTACTATGACGTCTACACCGCAAGGGATGTGTTGGAATCAGGACTCAGTCCAGGAAAGTATTATACTCATACACCAAGGAGGTGGAGCTGGATATTGAGACTGCAAAATCTAATTGAAAATGATTCTGGGGTCTATTACTGTGCCACCTGGGAC
TCTTC
TGTTGTCACAGGTAAGTATCGGAAGAAT
\ No newline at end of file
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment