Attention une mise à jour du service Gitlab va être effectuée le mardi 18 janvier (et non lundi 17 comme annoncé précédemment) entre 18h00 et 18h30. Cette mise à jour va générer une interruption du service dont nous ne maîtrisons pas complètement la durée mais qui ne devrait pas excéder quelques minutes.

Commit 10e8e9be authored by Mathieu Giraud's avatar Mathieu Giraud
Browse files

Merge branch 'feature-a/3910-avoir-des-germline-de-poulet' into 'dev'

Resolve "Avoir des germline de poulet"

Closes #3910

See merge request !478
parents 93d824ff 9ca09d24
Pipeline #235772 failed with stages
in 25 minutes and 52 seconds
# each of these sequences are compatible with allele 01 & 02.
# So a warning will be called
>IGLV1-1*01 0//2 IGLJ*01
CTGGGGTCCAAGCCGACGACGAGGCTGTCTATTACTGTGGGAGTGCAGACAGCAGCAGTACTGCTGGTATATTTGGGGCCGGGACAACCCTGACCGTCCTAGGCCAGCCCAAGGTGGCCCCCACCATCACCCTCTTCCCA
>IGLV1-1*01 0/C/6 IGLJ*01
GGTCCAAGCCGACGACGAGGCTGTCTATTACTGTGGGAGTGCAGACAGCAGCAGTACTGCTGCATTTGGGGCCGGGACAACCCTGACCGTCCTAGGCCAGCCCAAGGTGGCCCCCACCATCACCCTCTTCCCACCGTCAAAG
>IGLV1-4*01 0//6 IGLJ*01
GCCGACGACGAGGCTGTCTATTACTGTGGGAGTGCAGACAGCAGCTATGTTGGTATATTTGGGGCCGGGACAACCCTGACCGTCCTAGGCCAGCCCAAGGTGGCCCCCACCATCACCCTCTTCCCACCGTCAAAGGA
\ No newline at end of file
!LAUNCH: $VIDJIL_DIR/$EXEC -3 -c designations -g $VIDJIL_DIR/germline/gallus-gallus.g $VIDJIL_DATA/specie_gallus-gallus.fa
# each sequence here can be allele *01 or *02.
$ First clone is correctly found
1:IGLV1-1.01 0//2 IGLJ.01
$ Second clone is correctly found
1:IGLV1-1.01 0/C/6 IGLJ.01
$ Third clone is correctly found
1:IGLV1-4.01 0//6 IGLJ.01
......@@ -29,7 +29,7 @@
"follows": "IGH",
"recombinations": [ {
"5": ["IGHD+up.fa"],
"3": ["IGHJ+down.fa"]
"3": ["IGHJ.fa"]
} ],
"parameters": {
"seed": "12s"
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment