Commit 0e9a2171 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: remove TRD+ testing from trd-dd2-dd3.fa

TRDD2*01 is exactly 9 bp long. With SEED_9, we have in perfect Dd2 recombinations *one* matching k-mer.
The Dd2 TRD+ indexes have a load of around 0.05% and 0.16% (due to Dd3 or J), and thus, with the current e-value
computation, there is no chance to get a left e-value much smaller than 1e-3.
parent 0f85b47e
......@@ -2,15 +2,15 @@
gcaccatcagagagagatgaagggtcttactactgtgcctgtgacacc
acaccgataaactcatctttggaaaaggaacccgtgtgactgtggaaccaa
>TRDD2*01_0//0_TRDJ1*01__TRD+
>TRDD2*01_0//0_TRDJ1*01 TRD+
ccttcctac
acaccgataaactcatctttggaaaaggaacccgtgtgactgtggaaccaa
>TRDD2*01_0//0_TRDD3*01__TRD+
>TRDD2*01_0//0_TRDD3*01 TRD+
ccttcctac
actgggggatacg
>TRDV3*01_0//0_TRDD3*01__TRD+
>TRDV3*01_0//0_TRDD3*01 TRD+
atctctccagtaaggactgaagacagtgccacttactactgtgcctttag
actgggggatacg
......
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment