Commit 0c3599c7 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: second chimera sequence on TRG

Again, this sequence should not be segmented on IGL, but reported as AMBIGUOUS on TRG and not TOO_FEW_J.
parent a9b4ecc4
......@@ -4,4 +4,5 @@ $ Do not segment on IGL by chance
1:IGL .* 0
$ Report the sequence as AMBIGUOUS
1:UNSEG ambiguous .* 1
1:UNSEG ambiguous .* 2
>leu-trg-chimera
>leu-trg-chimera-1
ATTCTGGGGTCTATTACTGTGCCACCTGGGACAGGCCCCGGC
AAGATATTTGCTGAAGGGACTAAGCTCATAGTAACTTCGCCT
GGTAAGGAAGGCCCCACAGCGTCTTCTGTACTATGACGTCTC
CACCGCAAGGGATGTGTTGGAATCAGGACTCAGTCCAGGAAA
GTATTATACTCATACACCCAGGAGGTGGAGCTGGATATTGAG
ACTGCAAAATCTAATTGAAAATGATTCTGGG
>leu-trg-chimera-2
TGGGACAGGCCCCGGCAAGATATTTGCTGAAGGGACTAAGCT
CATAGAACTTCGCCTGGTAAGGAAGGCCCCACAGCATCTTCT
GTACTATGACGTCTCCACCGCAAGGGATGTGTTGGAATCAGG
ATCTCAGGT
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment