Nous avons procédé ce jeudi matin 08 avril 2021 à une MAJ de sécurité urgente. Nous sommes passé de la version 13.9.3 à la version 13.9.5 les releases notes correspondantes sont ici:

Commit 0a23db36 authored by Mikaël Salson's avatar Mikaël Salson

alternative_genes.should-get: Cannot determine the third alternative gene

IGHJ5*01 and IGHJ5*02 are equally good. Without #3414
we can have either sequences.

read             gactactggggccagggaaccctggtcaccgtctcctcag
IGHJ4*01   8     ..............A.........................
IGHJ4*02   8     ........................................
IGHJ4*02   8     ..............A..G......................
IGHJ5*01  11     ....C.........A.........................
IGHJ5*02  11     ...CC...................................
parent 0e317911
Pipeline #72452 passed with stages
in 35 minutes and 29 seconds
......@@ -5,7 +5,7 @@ $ Presence of alternative:
1: "3alt"
1: "name": "IGHJ4.02"
1: "name": "IGHJ4.01"
1a: "name": "IGHJ5.01"
1: "name": "IGHJ5.0[12]"
1: "4alt"
1: "name": "IGHD3-22.01"
1: "name": "IGHD3-10.02"
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment