Commit 09db6cc4 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: labeled window given with '-W'

parent e8ad8103
!LAUNCH: ../../vidjil -w 60 -G ../../germline/IGH -r 5 -W TGTGCGAGAGATGGACGGGATACGTAAAACGACATATGGTTCGGGGTTTGGTGCTTTTGA ../../data/Stanford_S22.fasta
$ Keep the good number of windows, including one window labeled by -W
1: keep 3 windows
$ The third clone has only one windows and the good label
1: clone-003.*0001-.* W
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment