Commit 08fbf9fc authored by Mathieu Giraud's avatar Mathieu Giraud

doc/README: update documentation with clones.vdj.fa + typos

parent ecc236bf
......@@ -102,8 +102,8 @@ require the "-G germline/IGH" and the "-d" options.
# Results are in out/segmented.vdj.fa, which is a FASTA file
# embedding heuristic information in the headers
# ('.vdj' format, see warning below)
# Summary of windows is also available in out/data.json
# ('.json' format, see below)
# Summary of windows is also available in out/vidji.data
# ('.data' format, see below)
>8--window--1
CACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCCA
......@@ -121,9 +121,12 @@ CTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACTACTACTACATGGACGTCTG
# A more natural option could be -R 5.
# For debug purpose, if one wants all the clones, use the option -A.
# No representative selection (-x)
# Results are on the standard output, additional files are
# in out/segmented.fa, out/windows.fa-* and out/clones*
# out/segmented.fa list segmented reads using the .vdj format (see below)
# Results are both
# - on the standard output
# - in out/clones.vdj.fa (fasta file to be processed by other tools)
# - in out/vidjil.data (for the browser)
# Additional files are in out/segmented.vdj.fa, out/seq/windows.fa-* and out/seq/clone.fa-*
# out/segmented.vdj.fa list segmented reads using the .vdj format (see below)
./vidjil -c clones -G germline/IGH -x -r 1 -R 5 -n 5 -d ./data/clones_simul.fa
# Window extraction + clone gathering,
......@@ -146,11 +149,12 @@ in the following situations:
the center of the window may be shifted up to 15 bases from the
actual center.
- in a second pass, on the standard output, at the end of the clones detection
(-c clones), or directly when explicitely requiring segmentation (-c segment)
- in a second pass, on the standard output
- at the end of the clones detection (-c clones, also in in 'clones.vdj.fa')
- or directly when explicitely requiring segmentation (-c segment)
This segmentation obtained by full comparison (dynamic
programming) with all germline sequences Such segmentation are
programming) with all germline sequences. Such segmentation are
not at the core of the Vidjil clone gathering method (which
relies only on the 'window', see above). They are provided only
for convenience and should be checked with other softwares such
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment