Commit 080ed75a authored by Mathieu Giraud's avatar Mathieu Giraud
Browse files

algo.org: remove '-d' and '-R' from examples

These options do not exist anymore.
parent 31b79a96
......@@ -145,9 +145,9 @@ Window prediction
(default: #####-#####, ######-######, #######-#######, depends on germline)
-k <int> k-mer size used for the V/J affectation (default: 10, 12, 13, depends on germline)
(using -k option is equivalent to set with -s a contiguous seed with only '#' characters)
-m <int> minimal admissible delta between last V and first J k-mer (default: -10) (default with -d: 0)
-M <int> maximal admissible delta between last V and first J k-mer (default: 20) (default with -d: 80)
-w <int> w-mer size used for the length of the extracted window (default: 40)(default with -d: 60)
-m <int> minimal admissible delta between last V and first J k-mer (default: -10) (default with -D: 0)
-M <int> maximal admissible delta between last V and first J k-mer (default: 20) (default with -D: 80)
-w <int> w-mer size used for the length of the extracted window (default: 40)(default with -D: 60)
#+END_EXAMPLE
The =-s=, =-k=, =-m= and =-M= options are the options of the seed-based heuristic. A detailed
......@@ -252,10 +252,10 @@ two windows that must be clustered.
* Examples of use
All the following examples are on a IGH VDJ recombinations : they thus
require the =-G germline/IGH= and the =-d= options.
require either the =-G germline/IGH= option, or the mutli-germline =-g germline= option.
#+BEGIN_SRC sh
./vidjil -G germline/IGH -d data/Stanford_S22.fasta
./vidjil -G germline/IGH data/Stanford_S22.fasta
# Extract (with an ultra-fast heuristic) all windows
# Summary of windows is available both in out/Stanford_S22.vdj.fa
# and in out/Stanford_S22.vidjil.
......@@ -273,7 +273,7 @@ CTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACTACTACTACATGGACGTCTG
The first window has 8 occurrences, the second window has 5 occurrences.
#+BEGIN_SRC sh
./vidjil -c clones -G germline/IGH -r 1 -R 1 -d ./data/clones_simul.fa
./vidjil -c clones -G germline/IGH -r 1 ./data/clones_simul.fa
# Extracts the windows (-r 1, with at least 1 read each),
# then gather them into clones
# A more natural option could be -r 5.
......@@ -288,13 +288,13 @@ CTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACTACTACTACATGGACGTCTG
#+END_SRC
#+BEGIN_SRC sh
./vidjil -c clones -G germline/IGH -r 1 -n 5 -d ./data/clones_simul.fa
./vidjil -c clones -G germline/IGH -r 1 -n 5 ./data/clones_simul.fa
# Window extraction + clone gathering,
# with automatic clustering, distance five (-n 5)
#+END_SRC
#+BEGIN_SRC sh
./vidjil -c segment -G germline/IGH -d data/segment_S22.fa
./vidjil -c segment -G germline/IGH data/segment_S22.fa
# Segment the reads onto VDJ germline
# (this is slow and should only be used for testing)
#+END_SRC
......
Supports Markdown
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment