Commit 0307a602 authored by flothoni's avatar flothoni
Browse files

issue data; 4606.vidjil, add 2 new clones

- one without subset
- one with subset 8
parent d01b157f
{
"clones": [
{
"_average_read_length": [
369.0
],
"_coverage": [
1.0
],
"_coverage_info": [
"369 bp (100% of 369.0 bp)"
"germline": "IGH",
"id": "GCAGCCTAAAGGCTGAGGACACCCGACAGGGTATGGACGTCTGGGGCCAA",
"name": "not subset seq; IGHV3-21/IGHJ6*02",
"reads": [
1
],
"sequence": "GGAGTCGGGGCCTGAGGTGAAGAAGCCTGGAGCCTCATTGAAGGTTTCCTGCAAGGCTTCTGGATACACCTTCACAAGCTATGCTATCAGCTGGGTATGACAGGCCCATGGACAAGGGCTTGAGGAAATGGGATGGATCAACACCAACACTGGGAACCTAACGTATGCCCAGGGCTTCACAGGACGGTTTGTCTTCTCCATGGACACCTCCGTCAGCATGGCATATCTTCATATCAGCAGCCTAAAGGCTGAGGACACCCGACAGGGTATGGACGTCTGGGGCCAAGGGACCCTGGTCACCGTCTCCTCAGGT",
"top": 0
},
{
"germline": "IGH",
"id": "subset_2_chimeric",
"name": "IGHV3-21*01 2/CTTTACCTCTGGGG/14 IGHD3-3*01 7/ACGGC/1 IGHJ6*02",
"name": "Subset2; IGHV3-21/IGHJ6*02",
"reads": [
3
1
],
"seg": {
"cdr3": {
"aa": "ARLYLWGEWLTAYYYYYGMDV",
"seq": "GCGAGACTTTACCTCTGGGGGGAGTGGTTAACGGCTTACTACTACTACTACGGTATGGACGTC",
"start": 268,
"stop": 330
},
"junction": {
"aa": "CARLYLWGEWLTAYYYYYGMDVW",
"productive": true,
"start": 265,
"stop": 333
}
},
"sequence": "GGGGGAGGCCTGGTCAAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATTAGTAGTAGTAGTAGTTACATATACTACGCAGACTCAGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAgatTACaatggaatggatgtgTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTAAG",
"top": 1
"top": 2
},
{
"germline": "IGH",
"id": "GTGCACGACGAACTGGATACAGTAGTAGTTGGTACGGAGGAGCAAACTGG",
"name": "subset#8 IGHV4-39*01/IGHJ5*01; unmutated",
"reads": [
1
],
"sequence": "CAGTAGTAGTTACTACTGGGGCTGGATCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGAGTATCTATTATAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTCACCATATCCGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCAGACACGGCTGTGTATTACTGTGCACGACGAACTGGATACAGTAGTAGTTGGTACGGAGGAGCAAACTGGTTCGACCCATGGGGCCAAGGAACCCTGGTCACCGTCTCCTCAG",
"top": 8
}
],
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment