Attention une mise à jour du service Gitlab va être effectuée le mardi 30 novembre entre 17h30 et 18h00. Cette mise à jour va générer une interruption du service dont nous ne maîtrisons pas complètement la durée mais qui ne devrait pas excéder quelques minutes. Cette mise à jour intermédiaire en version 14.0.12 nous permettra de rapidement pouvoir mettre à votre disposition une version plus récente.

Commit 02678ab3 authored by Mikaël Salson's avatar Mikaël Salson
Browse files

should-vdj: sequence identified by YF

parent 07adde3c
# Sequences split among two germlines (depending on the strand).
# Either VdJa (correct)
# or TRD (TRV1-TRDD2-TRDJ2)
>TRDV1*01_5//3_TRDD2*01_1//7_TRAJ29*01__VdJa
AGCGGGTGGTGATGGCAAATGCCAAGGAAGGGAAAAGGAAGAAGAGGGTTTTTATACTGATGTGTTTCATTGTGGGCACAGTGCTACAAAACCTACAGAGACCTGTACAAAAACTGCAGGGGCAAAAGTGCCATTTCCCTGGGATATCCTCACCCTGGTCCCAATGCAAAAAGTGGTCGCTATTCTGTCAACTTCAAGAAAGCAGCGAAATCCGTCGCCTTAACCATTTCAGCCTTACAGCTAGAAGATTCAGCAAAGTACTTTTGTGCTCTTGGGTCCTAAGGAAACACACCTCTTGTCTTTGGAAAGGGCACAAGACTTTCTGTGATTGCAAGTAAGTGTTTCTAGCCATCCTTGATTTTGATCAGCAATGGCTTCTTCCCTTGAATTATTTTTCAGTGTACCTAGAATGCTTTTGCC
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment