Commit 01fd38fb authored by Yann Ferret's avatar Yann Ferret Committed by Mathieu Giraud

tests: a TRG sequence

This test was not passing 10 days ago, before the work on close V-J xxx
parent 8cd0acdd
>TRGV5*01 4/2/5 TRGJP2*01 [TRG]
GGAAGGCCCCACAGCGTCTTCTGTACTATGACGTCTCCAACTCAAAGGATGTGTTGGAATCAGGACTCAGTCCAGGAAAGTATTATACTCATACACCCAGGAGGTGGAGCTGGATATTGATACTACGAAATCTAATTGAAAATGATTCTGGGGTCTATTACTGTGCCACCTGGGA
AG
AGTGATTGGATCAAGACGTTTGCAAAAGGGACTAGGCTCATAGTAACTTCGCCTGGTAA
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment