Attention une mise à jour du serveur va être effectuée le lundi 17 mai entre 13h et 13h30. Cette mise à jour va générer une interruption du service de quelques minutes.

Commit 00c9f9d3 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: remove $VIDJIL_DEFAULT_OPTIONS in the remaining cases, there are $EXTRA

see #3762
parent 8bc797d3
!LAUNCH: ($LAUNCHER $VIDJIL_DIR/$EXEC $EXTRA $VIDJIL_DEFAULT_OPTIONS -c germlines -g $VIDJIL_DIR/germline/homo-sapiens.g:TRA,TRB,TRD,TRG,IGH,IGK,IGL --trim 100 -s '######-######' $VIDJIL_DATA/Stanford_S22.fasta)
!LAUNCH: ($LAUNCHER $VIDJIL_DIR/$EXEC $EXTRA -c germlines -g $VIDJIL_DIR/germline/homo-sapiens.g:TRA,TRB,TRD,TRG,IGH,IGK,IGL --trim 100 -s '######-######' $VIDJIL_DATA/Stanford_S22.fasta)
$ number of reads and kmers
1:13153 reads, 3020179 kmers
!LAUNCH: (i=1; while [ $i -le 100000 ]; do echo '>read' ; echo ccgtgtattactgtgcgagagagctgaatacttccagcactg ; i=$((i+1)); done ;) > same-igh-100k.fa ; $LAUNCHER $VIDJIL_DIR/$EXEC $EXTRA $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -r 5000 -w 15 same-igh-100k.fa; rm -f same-igh-100k.fa
!LAUNCH: (i=1; while [ $i -le 100000 ]; do echo '>read' ; echo ccgtgtattactgtgcgagagagctgaatacttccagcactg ; i=$((i+1)); done ;) > same-igh-100k.fa ; $LAUNCHER $VIDJIL_DIR/$EXEC $EXTRA -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -r 5000 -w 15 same-igh-100k.fa; rm -f same-igh-100k.fa
$ Find a unique clone with all reads
!LAUNCH: $LAUNCHER $VIDJIL_DIR/$EXEC $EXTRA $VIDJIL_DEFAULT_OPTIONS -k 9 -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa -K -c clones $VIDJIL_DATA/revcomp.fa ; grep 'X.X.X' out/revcomp.affects | sed 's/[^X]//g' | sort -u ; grep '#>' out/revcomp.affects | sed 's/.*SEG.../e-value:/' | cut -f 1 -d' '
!LAUNCH: $LAUNCHER $VIDJIL_DIR/$EXEC $EXTRA -k 9 -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa -K -c clones $VIDJIL_DATA/revcomp.fa ; grep 'X.X.X' out/revcomp.affects | sed 's/[^X]//g' | sort -u ; grep '#>' out/revcomp.affects | sed 's/.*SEG.../e-value:/' | cut -f 1 -d' '
$ Segments both reads, normal and reverse
1:junction detected in 2 reads
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment