Commit 002adbd2 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: a sequence with a putative D/J overlap

parent 481d1894
# The D/J junction can be seen as 2//7, 3//6, or 4//5
>IGHV3-48*01 0/AA/6 IGHD5-12*01 3//6 IGHJ4*02 [IGH]
GGAGTCGGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCC
TCTGGATTCACCTTCAGTAGCTATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGG
GGCTGGAGTGGGTTTCATACATTAGTAGTAGTAGTAGTACCATATACTACGCAGACTC
TGTGAAGGGCCGATTCACCATCTCCAGAGACAATGCCAAGAACTCACTGTATCTGCAA
ATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGAAAATAGTG
GCTACGAT
TTGACTAC
TGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGTT
# IGHV3-48*01 ...TGTGTATTACTGTGCGAGAGA
# ...TGTGTATTACTGTGCGAGAGAAAATAGTGGCTACGATTTGACTACTGGGGCCAGGG...
# IGHD5-12*01 gtggAtATAGTGGCTACGATTac
# 4321
# IGHJ4*02 actacTTTGACTACTGGGGCCAGGG...
# 1234567
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment