-
Mikaël Salson authored
The dataset was generated to have a minority of sequences with a TTT insertion which would make it the sequence of choice with the default ReadScore (based on length and quality). On the contrary with a random sampler we should not be impacted by this insertion as it happens in the minority of sequences. Here is the command that generated the dataset: for i in $(seq 1 3500); do if [ $((RANDOM%3)) -ne 0 ]; then echo ">seq$i"; echo ctacctactactgtgccttgtgggaggtgatagtagtgattggatcaag; else echo ">seq$i"; echo cTTTtacctactactgtgccttgtgggaggtgatagtagtgattggatcaag; fi; done > test-random-consensus.fa
a5694371