Mentions légales du service

Skip to content
  • Mathieu Giraud's avatar
    tests: update tests, -e 10 for Stanford_S22.fasta · 88c3213c
    Mathieu Giraud authored
    With the new estimation of the p-value in affectanalyser.cpp, the following sequence
    has a p-value on the J side of about 3.58e-04, yielding an e-value of about 4.71 (there are 13,153 reads in Stanford-S22).
    
    Setting -e 10 enables thus this sequence to be still segmented.
    Changing seeds could maybe change these results.
    
    ===
    
    >lcl|FLN1FA001D7OE0.1
    GGCCTGGAGTGGATTGGGTACATCTATTACAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTTGCCATATCGGTAGACACGTCTAAGAACCAGTTCTCCCTGAAGTTGAGCTCTGTGACTGCCGCGGACACGGCCGTGTATTATTGTGCGAGAGTAGCAGCGGCTGCTCTTGACTCCTTGGGGCCAGGGAAGCCTGGTCACCTCTCCTCAGG
    73 + VJ      0 158 187 220    seed IGH SEG_+ 3.583786e-04 2.531831e-182/3.583786e-04
     _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X _ _ _ _ _ _+X _ _ _ _ _ _ _+X _ _ _ _ _ _+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X _ _ _ _ _ _+X _ _ _ _ _ _+X+X ?+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X+X _ _ _ _+X+X+X _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _+x _ _ _ _ _ _+x _ _ _ _ _ _ _ _ _ _ _ _ _ _
    88c3213c