analysis-with-windows.analysis 1.92 KB
Newer Older
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
{
  "vidjil_json_version": "2014.10",
  
  "reads": {
    "germline": { "IGH": [ 13139 ] }, 
    "segmented": [ 13139 ], 
    "total": [ 13153 ]
  },
  
  "samples": {
    "commandline": [ "/some/cmd"  ], 
    "log": [ "/some/log" ], 
    "number": 1, 
    "original_names": [ "/some.fasta" ], 
    "producer": [ "vidjil dev 83a82c1 (2015-02-24)" ], 
    "run_timestamp": [ "2015-02-24 23:52:34" ]
  }, 
  
  "clones": [
    {
      "germline": "IGH", 
      "id": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC",
      "sequence": "GCTGTACCTGCAAATGAACAGCCTGCGAGCCGAGGACACGGCCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCCAGGGGATCCTGGTCACCGTCTCCTCAG", 
      "top": 1,
      "name": "IGHV3-23*05 -6/18/-9 IGHD6-13*01 -0/0/-2 IGHJ4*02", 
      "reads": [ 8 ], 
      "seg": {
        "3": "IGHJ4*02", 
        "3start": 82, 
        "4": "IGHD6-13*01", 
        "4end": 81, 
        "4start": 73, 
        "5": "IGHV3-23*05", 
        "5end": 54, 
        "5start": 0
      }
    },
    {
      "germline": "IGH", 
      "id": "CCACCTATTACTGTACCGGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC",
      "sequence": "GCTGTACCTGCAAATGAACAGCCTGCGAGCCGAGGACACGGCCACCTATTACTGTACCGGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCCAGGGGATCCTGGTCACCGTCTCCTCAG", 
      "top": 2,
      "name": "Same than top-1, one mutation C>G at 18th position of the window", 
      "reads": [ 6 ]
    }, 
    {
      "germline": "IGH", 
      "id": "TGTGCGAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACTACTAC",
      "sequence": "GGACACGGCCGTGTATTACTGTGCGAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCAC", 
      "top": 2,
      "name": "IGHV1-8*01 -0/0/-3 IGHD3-22*01 -3/12/-5 IGHJ6*03", 
      "reads": [ 5 ], 
      "seg": {
        "3": "IGHJ6*03", 
        "3start": 67, 
        "4": "IGHD3-22*01", 
        "4end": 54, 
        "4start": 30, 
        "5": "IGHV1-8*01", 
        "5end": 29, 
        "5start": 0
      }
    }
  ]
}