stanford-fuse.should_get 515 Bytes
Newer Older
1
!LAUNCH: ../../vidjil -G ../../germline/IGH ../../data/Stanford_S22.fasta ; python ../../tools/fuse.py out/Stanford_S22.vidjil out/Stanford_S22.vidjil -o out/fused.data ; cat out/fused.data | sh format-json.sh
2 3

$ Points list
4
f1:"point": [ "", "" ]
5 6

$ Most abundant window, twice, fused 
7
f1:"id": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC", .*"reads": [ 8, 8 ]
8

9
# Fails since 49046ca6b97, no more 'others'
10
$ Windows that are not in the top 50
11
f1:"window": "others-1", .* "size": [ 12962, 12962 ]