stanford-fuse.should-get 717 Bytes
Newer Older
1 2
!REQUIRES: python $VIDJIL_DIR/tools/check_python_version.py
!LAUNCH: $VIDJIL_DIR/vidjil -z 0 -w 60 -G $VIDJIL_DIR/germline/IGH $VIDJIL_DIR/data/Stanford_S22.fasta ; python $VIDJIL_DIR/tools/fuse.py out/Stanford_S22.vidjil out/Stanford_S22.vidjil -o out/fused.data ; cat out/fused.data | python $VIDJIL_DIR/tools/format_json.py -1
3 4

$ Points list
Mathieu Giraud's avatar
Mathieu Giraud committed
5
e1:"original_names": ["../../..//data/Stanford_S22.fasta", "../../..//data/Stanford_S22.fasta"]
6 7

$ Most abundant window, twice, fused 
8
1:"id": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC".*"reads": \\[8, 8\\].*"top": 2
9

10
# Fails since 49046ca6b97, no more 'others'
11
$ Windows that are not in the top 50
12
f1:"window": "others-1", .* "size": [ 12962, 12962 ]