specie_gallus-gallus.fa 589 Bytes
Newer Older
1
2
3
4
5
6
7
8
# each of these sequences are compatible with allele 01 & 02.
# So a warning will be called
>IGLV1-1*01 0//2 IGLJ*01
CTGGGGTCCAAGCCGACGACGAGGCTGTCTATTACTGTGGGAGTGCAGACAGCAGCAGTACTGCTGGTATATTTGGGGCCGGGACAACCCTGACCGTCCTAGGCCAGCCCAAGGTGGCCCCCACCATCACCCTCTTCCCA
>IGLV1-1*01 0/C/6 IGLJ*01
GGTCCAAGCCGACGACGAGGCTGTCTATTACTGTGGGAGTGCAGACAGCAGCAGTACTGCTGCATTTGGGGCCGGGACAACCCTGACCGTCCTAGGCCAGCCCAAGGTGGCCCCCACCATCACCCTCTTCCCACCGTCAAAG
>IGLV1-4*01 0//6 IGLJ*01
GCCGACGACGAGGCTGTCTATTACTGTGGGAGTGCAGACAGCAGCTATGTTGGTATATTTGGGGCCGGGACAACCCTGACCGTCCTAGGCCAGCCCAAGGTGGCCCCCACCATCACCCTCTTCCCACCGTCAAAGGA