gosh-igh.should-vdj.fa 24.4 KB
Newer Older
1
#1473 vh1
Mikaël Salson's avatar
Mikaël Salson committed
2
>IGHV1-2*04 0/7/11 IGHD2-2*02 1/5/5 IGHJ6*03  [IGH]
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
GGTGCAGATCTCCTGCAGGCTTCTGGATACACCTTCACCGGCTACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAACCCTAACAGTGGTGGCACAAACTATGCACAGAAGTTTCAGGGCTGGGTCACCATGACCAGGGACACGTCCATCAGCACAGCCTACATGGAGCTGAGCAGGCTGAGATCTGACGACACGGCCGTGTATTACTGTGCGAGAGAGAGTGGGGTAGTACCAGCTGCTATACGCCCGTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAGGTAAAA

#1473 vh3(s)
>IGHV3-23*01 15/10/5 IGHD6-6*01 2/8/5 IGHJ4*02  [IGH]
GCCTGGGATCATTTAGCAGCTATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGCTATTAGTGGTAGTGGTGGTAGCACATACTACGCAGACTCCGTGAAGGGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTATACGTCGCCCTTTAGCAGCTCGTAGGATCTTTTTGACTACTGGGACCAGGGAACCCTGGTCACCGTCTCCTCAGGTA

#1473 vh3(l)
>IGHV3-53*01 2/9/10 IGHD3-10*01 4/8/1 IGHJ6*02  [IGH]
GCGGGTCGTCAGTAGCACTACATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGTTATTTATAGCGGTGGTAGCACATACTACGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCGAGACGTTTGTTGGGTTCGGGGAGTTATTAACCTTGGGTTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTA

#1473 vh4
>IGHV4-55*01 1/14/10 IGHD3-10*01 4/8/1 IGHJ6*02  [IGH]
GTATCTGCGCTGTCTCTGGTGACTCCATCAGCAGTGGTAACTGGTGAATCTGGGTCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGGAAATCCATCATAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAATCACCATGTCCGTAGACACGTCCAAGAACCAGTTCTACCTGAAGCTGAGCTCTGTGACCGCCGCGGACACGGCCGTGTATTACTGTGCGAGATTCCCACGTTTGTTGGGTTCGGGGAGTTATTAACCTTGGGTTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTA

#1469 vh3(s)
18
>IGHV3-13*01 0/13/5 IGHD6-13*01 2/4/4 IGHJ6*02  [IGH] BUG
19
20
21
GCGGGATCCTTCGTAGCTACGACATGCACTGGGTCCGCCAAGCTACAGGAAAAGGTCTGGAGTGGGTCTCAGCTATTGGTACTGCTGGTGACACATACTATCCAGGCTCCGTGAAGGGCCGATTCACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTCAAATGAACAGCCTGAGAGCCGGGGACACGGCTGTGTATTACTGTGCAAGAGATGGGTAGAGCCCCTAGCAGCAGCTGCTTGATCTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGATCACCGTCTCCTCAGGTACA

#1469 vh3(l)
Mikaël Salson's avatar
Mikaël Salson committed
22
23
24
25
# sequence:  GAGAGCCCTGTATAGCAGCA
#            |||||
# IGHV3-30-3 GAGAGA   |||||||||||
# IGHD6-13          gggtatagcagcagctggtac
26
>IGHV3-30-3*01 1/5/2 IGHD6-13*01 3/0/0 IGHJ3*02  [IGH] BUG
Mikaël Salson's avatar
Mikaël Salson committed
27
GCCATTGGGATCCGTTCGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCACTTATATCATATGATGGAAGCAATAAATACTACGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAGAGCCCTGTATAGCAGCAGCTGGTGATGCTTTTGATATCTGGGGCCAAGGGACAATGGT
28
29

#1466 vh3
30
>IGHV3-64*01 1/23/7 IGHD1-1*01 3/0/6 IGHJ4*02  [IGH] BUG
31
32
33
GGCTTATCCTTCGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGGAAGGGACTGGAATAGTGTTTCAGCTATTAGTAGTAATGGGGGTAGCACATATTATGCAAACTCTGTGAAGGGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGGGCAGCCTGAGAGCTGAGGACATGGCTGTGTATTACTGTGCGAGAGGAGGGGCCCATGAGAAGCGATGTCTGGAACTTGACTACTGGGGCCAGGGAACGCTGGTCACCGTCTCCTCTAGTAGTACTAGTA

#1465 vh1
34
>IGHV1-69*01 0/8/0 IGHD3-16*01 30/8/22 IGHJ6*02  [IGH] BUG
35
36
37
38
39
40
41
CGGGGTAGGTCTCTGCAGGCTTCTGGAGGCACCTTCAGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATCTTTGGTACAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACGAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGATAAGGCCAGTATTATCCCGTGGAGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTA

#1465 vh6
>IGHV6-1*01 4/14/1 IGHD2-2*01 7/8/6 IGHJ6*02  [IGH]
CTCCTGTGCATCTCCGGGGACAGTGTCTCTAGCAACAGTGCTGCTTGGAACTGGATCAGGCAGTCCCCATCGAGAGGCCTTGAGTGGCTGGGAAGGACATACTACAGGTCCAAGTGGTATAATGATTATGCAGTATCTGTGAAAAGTCGAATAACCATCAACCCAGACACATCCAAGAACCAGTTCTCCCTGCAGCTGAACTCTGTGACTCCCGAGGACACGGCTGTGTATTACTGTGCAACGGGGGGTTCTGCGGGATATTGTAGTAGTACCAGCTGTCCCTCGGACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGT

#1465 dh3
Mikaël Salson's avatar
Mikaël Salson committed
42
43
44
45
46
#sequence:         TGGTATTACGATTTTCGGAGCCAGGGCCAAGGGACCACGGTCACCGTCTCCGCA
#                  ||||||||||||||| ||||
#IGHD3-3:          TGGTATTACGATTTTTGGAGTGGTTATTATACC
#                                         |||||||||||||||||||||||||||||||
#IGHJ6*02: ATTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCA
47
>IGHD3-3*01 (13/3/31, 18/8/31) IGHJ6*02  [IGH+] BUG
48
49
50
TCTGGCGTGATTTGGGGGGCAATTTATAAACCCAAAAGGACATGGCCATGCAGCGGGTAGGGACAATACAGACACGATATCAGCCTGAAATGGAGCCTCAGGGCACAGGTGGGCACGGACACTGTCCACCTAAGCCAGGGGCAGACCCGAGTGTCCCCGCAGTAGACCTGAGAGCGCTGGGCCCACAGCCTCCCCTCGGTGCCCTGCTACCTCCTCAGGTCAGCCCTGGACATCCCGGGTTTCCCCAGGCCTGGCGGTAGGTTTGGGGTGAGGTCTGTGTCACTGTGGTATTACGATTTTCGGAGCCAGGGCCAAGGGACCACGGTCACCGTCTCCGCAGGTAACC

#1463 vh3
51
>IGHV3-23*01 2/15/7 IGHD6-19*01 0/4/5 IGHJ6*02  [IGH] BUG
52
53
54
55
56
57
58
59
60
61
62
CGGCATCTTTAGCAGCTATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGCTATTAGTGGTAGTGGTGGTAGCACATACTACGCAGACTCCGTGAAGGGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTATATTACTGTGCGAAACCTAGTAGGGGGAGCGCAGCTCGTCCTGAGTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTCAACGATGCTCTACGGTACGAGTTTCTACCGTAATAACGGTACTCACCACGGAGCTGCGGTCCCCCTACTAGGTTTGCAAGTGATATACGGAAATGTCCTCGGTTCTTAGGCTAATCGTCTGCCGATACAGCGTGTTTTTGGAAATTTACTCTGGACAATAGAGAATAGACCCTCACG

#1463 dh6
>IGHD6-19*01 3/6/2 IGHJ5*02  [IGH+]
AGAGGTTTCTGAGCTGTCTGTATCACAGTGGGGTATAGCAGTGGCTGGCCCCAAAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAACAAGGTTGCCAGGCCCGGGGTTCGAACCTTTTTAGGGCCGCCACTGCTGTACCCCACTGTGATACAGACGCTTACAGAACCTCCTCTTCTCTTTTAAGGAGCCGTCCCTTGCTGGGTCAAAA

#kw229 vh3
>IGHV3-11*01 5/11/0 IGHD2-15*01 5/10/0 IGHJ6*02  [IGH]
GGGGGGATCCTTCAGTGACTACTACATGAGCTGGATCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTTCATACATTAGTAGTAGTGGTAGTACCATATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGGGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCGGGGGGGGTGAGAGGATATTGTAGTGGTGGTAGCTGCTCCAACCCTCTATTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGG

#kw229 dh3
63
>IGHD3-9*01 3/0/0 IGHJ5*02  [IGH+] BUG
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
GCTCTGTGATTTGTGGGCAACTTATGAACCCGAAAGGACATGGCCATGGGGTGGGTAGGGACATAGGGACAGATGCCAGCCTGAGGTGGAGCCTCAGGACACAGGTGGGCACGGACACTATCCACATAAGCGAGGGATAGACCCGAGTGTCCCCACAGCAGACCTGAGAGCGCTGGGCCCACAGCCTCCCCTCAGAGCCCTGCTGCCTCCTCCGGTCAGCCCTGGACATCCCAGGTTTCCCCAGGCCTGCCGGTAGGTTTAGAATGAGGTCTGTGTCACTGTGGTATTACGATATTTTGACTGGTTATTATATTACTACTACTACTACGGTATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAGGTA

#kw228 dh3
>IGHD3-9*01 16/9/2 IGHJ6*03  [IGH+]
ATCTGTGATTTGTGGGCACTTATGAACCCGAAAGGACATGGCCATGGGGTGGGTAGGGACATAGGGACAGATGCCAGCCTGAGGTGGAGCCTCAGGACACAGGTGGGCACGGACACTATCCACATAAGCGAGGGATAGACCCGAGTGTCCCCACAGCAGACCTGAGAGCGCTGGGCCCACAGCCTCCCCTCAGAGCCCTGCTGCCTCCTCCGGTCAGCCCTGGACATCCCAGGTTTCCCCAGGCCTGCCGGTAGGTTTAGAATGAGGTCTGTGTCACTGTGGTATTACGATATTTTTTGTCCAACTACTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAGGTAATA

#kw228 dh6
>IGHD6-19*01 0/18/0 IGHJ4*02  [IGH+]
TGAGGTTTCTGAGCTGTCTGTATCACAGTGGGGTATAGCAGTGGCTGGTACGTGGTGCGGTGCGCCCCGACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAACACCC

#gos271 vh1
>IGHV1-46*01 IGHD2-21*02 IGHJ5*02  [IGH]
GCTGGCAGATTCTGCAGGCATCTGGATACACCTTCACCAGCTACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAATAATCAACCCTAGTGGTGGTAGCACAAGCTACGCACAGAAGTTCCAGGGCAGAGTCACCATGACCAGGGACACGTCCACGAGCACAGTCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGGTTTTCCTAGCATATTGTGGTGGTGACTGCTATTCGACAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAAATT

#1428 vh1
79
>IGHV1-69*13 IGHD1-7*01 IGHJ6*02  [IGH] BUG
80
81
82
CGGGGTAGTCTCCTGCAGCTTCTGGAGGCACCTTCAGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATCTTTGGTACAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACGAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGGGGGGGCTGGAACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTAAAACTTATCCTTGGAAAGACGTCATCCGTAGTAGTAGTTCAGCCCCCCTGCCGTAATACAGGCCGTGTCTCGATCTCAGCGGCTCACTCCTGGTGGGCTGTGCTTGTGGAATTCTCCCGGTAATCGTGACTTTGCCCTGGAAATTCTATGCCTATTGTTGCTGGACC

#1428 vh2
83
>IGHV2-70*04 IGHJ6*02  [IGH] BUG
84
85
86
87
88
89
90
CCACAGACCCTCACACTGACCTGCACCTTCTCTGGGTTCTCACTCAGCACTAGTGGAATGCGTGTGAGCTGGATCCGTCAGCCCCCAGGGAAGGCCCTGGAGTGGCTTGCACGCATTGATTGGGATGATGATAAATTCTACAGCACATCTCTGAAGACCAGGCTCACCATCTCCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAACATGGACCCTGTGGACACAGCCACGTATTACTGTGTTGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTAAAACCACGTCCTTGGCCCGACTCCATACCACACCTAATACCTGGCTGTGTCCACGAGGATCCATGGTTGGGCATTGTAGGACCACTGGTTTTTGGAAGTTCCCTTGAGAAAAGAAAAACAGAATCTTCAAAAAA

#1428 vh3
>IGHV3-30*18 IGHD3-22*01 IGHJ2*01  [IGH]
CGCCATGATCTTCGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGATGGAAGTAATAAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAACCGAGACCCTAATTCCTTTTATTACTATGATAGTAGTGGTTATTTGGTACTTCGATCTCTGGGGCCGTGGCACCCTGGTCACCGTCTCCTCAGGTCAAACCAGGTGCAGGCGCATGATCGAAGTACAAATAACACTACTATCAAAGTAATAAAAGGGAATTATGGGTTCGGTTCCACGTTA

#1428 vh4
91
>IGHV4-31*03 IGHD1-7*01 IGHJ6*02  [IGH] BUG
92
93
94
ATCTACTGCACTGTCTCTGGTGGCTCCATCAGCAGTGGTGGTTACTACTGGAGCTGGATCCGCCAGCACCCAGGGAAGGGCCTGGAGTGGATTGGGTACATCTATTACAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTTACCATATCAGTAGACACGTCTAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACTGCCGCGGACACGGCCGTGTATTACTGTGCGGTGGGGGGGATCAACTGGAACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTAAAACCGTATCCTTGCGCAGACCTCATGCCGTCGTAATATTTCAGTTGATCCCCCCCACCGCAAATAATACAGGTCCTGGTTGCGCCTCAAAATTTTAACTTAGGGAGAAACTGGGTCTTAGAAG

#1416 vh1
95
>IGHV1-2*02 3/7/10 IGHD6-13*01 3/6/0 IGHJ5*02  [IGH] BUG
96
97
98
TAGTCTCCTGCAGGCTTCTGGATACACCTTCACCGGCTACTATATGCACTGGGTGCGACAGGCCCCTGSACAAGGGCTTGAGTGGATGGGATGGATCAACCCTAACAGTGGTGGCACAAACTATGCACAGAAGTTTCAGGGCAGGGTCACCATGACCAGGGACACGTCCATCAGCACAGCCTACATGGAGCTGAGCAGGCTGAGATCTGACGACACGGCCGTGTATTACTGTGCGAGGCCAGAGGCAGCTGGGGGAGAACAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTA

#1416 vh3
99
>IGHV3-30-3*01 0/10/1 IGHD6-13*01 3/6/0 IGHJ5*02  [IGH] BUG
100
101
102
GTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGATGGAAGCAATAAATACTACGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAGAGGGATAAAACGGTATAGCAGCAGCTGGGGGAGAACAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTA

#1416 dh5
103
>IGHD5-18*01 5/12/15 IGHJ6*03  [IGH+] BUG
104
105
106
ACCCCMTGTCCAGTCCTGGGGGCCCCTGGCACAGCTGTCTGGACCCTCTCTATTCCCTGGGAAGCTCCYCCTGACAGCCCCGCCTCCAGTTCCAGGTGTGGTTATTGTCAGGGGGTGTCAGACTGTGGTGGATACAGCTATGACCCCCCCAAAGACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAGG

#1411 vh1
107
108
109
110
# sequence:    GTGTATTACTGTGCGGCATCCTCCTTGGTAGGTATTACTATGGTTCGGGGAGTTATTATAACTTTGACTACTGGGGCCAGGGAACGCTGGTCACCGTC
#              ||||||||||||||||||
# IGHV1-58*02  GTGTATTACTGTGCGGCAGA           |||||||||||||||||||||||||||||||
# IGHD3-10*01                                 GTATTACTATGGTTCGGGGAGTTATTATAAC
111
#                                                                          ||||||||||||||||||
112
# IGHJ4*02                                                              ACTACTTTGACTACTGGGGCC
113
>IGHV1-58*02 2/13/0 IGHD3-10*01 (2/0/3, 1/0/4, 0/0/5) IGHJ4*02  [IGH]
114
115
116
CGGCAGTCTCCTGCAGGCTTCTGGATTCACCTTTACTAGCTCTGCTATGCAGTGGGTGCGACAGGCTCGTGGACAACGCCTTGAGTGGATAGGATGGATCGTCGTTGGCAGTGGTAACACAAACTACGCACAGAAGTTCCAGGAAAGAGTCACCATTACCAGGGACATGTCCACAAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCCGAGGACACGGCCGTGTATTACTGTGCGGCATCCTCCTTGGTAGGTATTACTATGGTTCGGGGAGTTATTATAACTTTGACTACTGGGGCCAGGGAACGCTGGTCACCGTCTCCTCAGGTAAA

#1400 vh2
117
>IGHV2-5*10 2/11/11 IGHD2-2*02 0/6/0 IGHJ6*03  [IGH] BUG
118
119
120
AAACAGACCCTCACGCTGACCTGCACCTTCTCTGGGTTCTCACTCAGCACTAGTGGAGTGGGTGTGGGCTGGATCCGTCAGCCCCCAGGAAAGGCCCTGGAGTGGCTTGCACTCATTTATTGGGATGATGATAAGCGCTACAGCCCATCTCTGAAGAGCAGGCTCACCATCACCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAACATGGACCCTGTGGACACAGCCACATATTACTGTGCACACCGGCCCCGGGTAGTACCAGCTGCTATACCCTTAATATTACTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAG

#1400 vh3
Mikaël Salson's avatar
Mikaël Salson committed
121
122
123
124
125
126
127
# sequence:     GTGTATTACTGTGCGAGAGATAAAAGGGATTACTATGGTTCAGGGAGTTATTTTTGACTA
#               ||||||||||||||||||||        ||||||||||||| ||||||||||
# IGHV3-53*01:  GTGTATTACTGTGCGAGAGA
# IGHD3-10*01:                            GTATTACTATGGTTCGGGGAGTTATTATAAC
#                                                                   |||||||
# IGHJ4*02:                                                    ACTACTTTGACTACTGGGGCCAGGGAACCCTGG
>IGHV3-53*01 0/8/2 IGHD3-10*01 5/0/5 IGHJ4*02  [IGH]
128
129
130
GGGGCTCGTCAGTAGCACTACATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGTTATTTATAGCGGTGGTAGCACATACTACGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCGAGAGATAAAAGGGATTACTATGGTTCAGGGAGTTATTTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGG

#1387 vh3
131
>IGHV3-13*05 2/1/0 IGHD3-9*01 8/7/0 IGHJ3*01  [IGH] BUG
132
133
134
GCTGGATCCTTCGTAGCTACGACATGCACTGGGTCCGCCAAGCTACAGGAAAAGGTCTGGAGTGGGTCTCAGCTATTGGTACTGCTGGTGACCCATACTATCCAGGCTCCGTGAAGGGCCGATTCACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTCAAATGAACAGCCTGAGAGCCGGGGACACGGCTGTGTATTACTGTGCAAGACGTATTACAATATTTTGACTGGTTCCCGGGATGATGCTTTTGATATCTGGGGCCAAGGGACAACGGTCATCGTCTCCTA

#1387 vh4
135
>IGHV4-59*01 0/5/3 IGHD4-17*01 0/16/1 IGHJ6*03  [IGH] BUG
136
137
138
CCTAACTGCACTGTCTCTGGTGGCTCCATCAGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTACTGTGCGAGAGATCCCTACGGTGACTACGTACCTGAAACCTCTCTTACTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAGGT

#1383 vh3
139
>IGHV3-15*01 0/4/3 IGHD3-9*01 3/6/11 IGHJ6*03  [IGH] BUG
140
141
142
GGCCTGCATCTTTCGTACGCCTGGATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTGGCCGTATTAAAAGCAAAACTGATGGTGGGACAACAGACTACGCTGCACCCGTGAAAGGCAGATTCACCATCTCAAGAGATGATTCAAAAAACACGCTGTATCTGCAAATGAACAGCCTGAAAACCGAGGACACAGCCGTGTATTACTGTACCACAGATCCCTTACGATATTTTGACTGGTTATTATTAGTTGCTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAGGTACCAA

#1383 vh4
143
>IGHV4-31*03 3/5/3 IGHD3-9*01 3/6/11 IGHJ6*03  [IGH] BUG
144
145
146
CTCTACCTGCACTGTCTCTGGTGGCTCCATCAGCAGTGGTGGTTACTACTGGAGCTGGATCCGCCAGCACCCAGGGAAGGGCCTGGAGTGGATTGGGTACATCTATTACAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTTACCATATCAGTAGACACGTCTAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACTGCCGCGGACACGGCCGTGTATTACTGTGCGAGGGGTCTTACGATATTTTGACTGGTTATTATTAGTTGCTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAGGTA

#1378 vh3
147
>IGHV3-13*01 1/14/7 IGHJ4*02  [IGH] BUG
148
149
150
GCGGGATCCTTCGTAGCTACGACATGCACTGGGTCCGCCAAGCTACAGGAAAAGGTCTGGAGTGGGTCTCAGCTATTGGTACTGCTGGTGACACATACTATCCAGGCTCCGTGAAGGGCCGATTCACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCAAGAGTCTCTGGGACTTCGTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCAGCAGGTAAAA

#1383 dh3
151
>IGHD3-9*01 7/0/6 IGHJ4*02  [IGH+] BUG
152
153
154
AGCTCTGCTGATTTGTGGGCACTTATGAACCCGAAAGGACATGGCCATGGGGTGGGTAGGGACATAGGGACAGATGCCAGCCTGAGGTGGAGCCTCAGGACACAGGTGGGCACGGACACTATCCACATAAGCGAGGGATAGACCCGAGTGTCCCCACAGCAGACCTGAGAGCGCTGGGCCCACAGCCTCCCCTCAGAGCCCTGCTGCCTCCTCCGGTCAGCCCTGGACATCCCAGGTTTCCCCAGGCCTGCCGGTAGGTTTAGAATGAGGTCTGTGTCACTGTGGTATTACGATATTTTGACTGGTTATTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTA

#1349 vh3
155
>IGHV3-23*01 1/15/5 IGHD3-10*01 0/2/0 IGHJ3*02  [IGH]
156
157
158
CGCCCCACTTGATATTCCTTTTAGCCAGCTATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGCTATTAGTGGTAGTGGTGGTAGCACATACTACGCAGACTCCGTGAAGGGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTATATTACTGTGCGAAAGGGTGGGAGGTATTAAACTATGGTTCGGGGAGTTATTATAACGTTGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCCTCAGGTAACTC

#1347 vh2
159
>IGHV2-26*01 0/5/5 IGHD5-24*01 4/13/7 IGHJ4*02  [IGH]
160
161
162
TCAGAGACCTCACGCTGACCTGCACCGTCTCTGGGTTCTCACTCAGCAATGCTAGAATGGGTGTGAGCTGGATCCGTCAGCCCCCAGGGAAGGCCCTGGAGTGGCTTGCACACATTTTTTCGAATGACAAAAAATCCTACAGCACATCTCTGAAGAGCAGGCTCACCATCTCCAAGGACACCTCCAAAAGCCAGGTGGTCCTTACCATGACCAATATGGACCCTGTGGACACAGCCACATATTACTGTGCATGGATACCCGAGGATGGCTACAACGACAAGAGCCAATGACTACTGGGGCCAGGGAACGCTGGTCACCGTCTCCTCAGGTAAATCCATGCACAGTAATATGTGGCTGTGTCCACAGGGTCCATATTGGTCATGGTAAGGACCACCTGGCTTTTGGAGGTGTCCTTGGAGA

#1339 vh3
163
>IGHV3-33*01 0/8/4 IGHD6-19*01 3/0/5 IGHJ4*02  [IGH] BUG
164
165
166
GAACGGATAACTTCGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATGGTATGATGGAAGTAATAAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGATCGAAGTGATAGCAGTGGCTGGTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAA

#1339 dh2
167
>IGHD2-2*01 10/3/1 IGHJ6*02  [IGH+] BUG
168
169
170
ATTAGACAAAAACCCCCTGGAATCATAGTATCAGCAGGAGAACTAGCCAGAGACAGCAAGAGGGGACTCAGTGACTCCCGCGGGGACAGGAGGATTTTGTGGGGGCTCGTGTCACTGTGAGGATATTGTAGTAGTACCAGACCTTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGT

#1334 vh3
171
>IGHV3-13*01 5/6/0 IGHD7-27*01 1/16/11 IGHJ4*02  [IGH] BUG
172
173
174
GGAATGATCCTTCGTAGCTACGACATGCACTGGGTCCGCCAAGCTACAGGAAAAGGTCTGGAGTGGGTCTCAGCTATTGGTACTGCTGGTGACCCATACTATCCAGGCTCCGTGAAGGGCCGATTCACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTCAAATGAACAGCCTGAGAGCCGGGGACACGGCTGTGTATTACTGTGCAGACACCCTAACTGGGGGGGGTTCCCTTGGGGGTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAA

#1334 dh2
175
>IGHD2-2*01 7/13/19 IGHJ6*02  [IGH+] BUG
176
177
178
179
180
181
182
ATTAGACAAACCCCCTGGAATCATAGTATCAGCAGGAGAACTAGCCAGAGACAGCAAGAGGGGACTCAGTGACTCCCGCGGGGACAGGAGGATTTTGTGGGGGCTCGTGTCACTGTGAGGATATTGTAGTAGTACCAGCTGTCATATTCGGGGATATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTCAAACC

#1334 dh3
>IGHD3-9*01 5/13/11 IGHJ6*02  [IGH+]
GCTCTGTGATTTGTGGGCACTTATGAACCCGAAAGGACATGGCCATGGGGTGGGTAGGGACATAGGGACAGATGCCAGCCTGAGGTGGAGCCTCAGGACACAGGTGGGCACGGACACTATCCACATAAGCGAGGGATAGACCCGAGTGTCCCCACAGCAGACCTGAGAGCGCTGGGCCCACAGCCTCCCCTCAGAGCCCTGCTGCCTCCTCCGGTCAGCCCTGGACATCCCAGGTTTCCCCAGGCCTGGCGGTAGGTTTAGAATGAGGTCTGTGTCACTGTGGTATTACGATATTTTGACTGGTTATTGCGGCCCCTGAAGTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTAGACGTGCCTCTTGGCCCAGACGTCATACGTAATACTTCAGGGCCGCAATAACCCGTCAAAATATCGTAAATACCCCCTGACCCAACCTCACTCTAAACT

#1318 vh3
183
>IGHV3-21*01 35/8/9 IGHJ6*02  [IGH] BUG
184
185
186
CGGCATCCTTCGTAGCTATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATTAGTAGTAGTAGTAGTTACATATACTACGCAGACTCAGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGACCTTTCTTCGAGGGACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCGTCAGGTA

#1317 vh3
187
>IGHV3-30-3*01 0/8/9 IGHD1-26*01 2/0/0 IGHJ5*02  [IGH] BUG
188
189
190
GCGGGATACTTCAGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGATGGAAGCAATAAATACTACGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAGAGATCCCATGGAGCTACTACAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCGACAGGTATCAAACAACTGGTTCGACCCCTGGGGCCA

#1317 dh4
191
>IGHD4-11*01 8/14/2 IGHJ5*02  [IGH+] BUG
192
193
194
GGGACAGACGCCTGGACAGGGCCTGCGTGGGAAGGCCTCTGGGCACACTCAGGGGCTTTTTGTGAAGGGTCCTCCTACTGTGTGACTACATTTAGGGTTGGGGTAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTA

#1317 dh5
195
>IGHD5-12*01 2/12/3 IGHD7-27*01 0/10/20 IGHJ5*02  [IGH+] BUG
196
197
198
TCAGCCCCCAACGGTCCCCAGTCCTGGGGGCCCCTGGCTCAGCTGTCTGGACCCTCCCTGTTCCCTGGGAAGCTCCTCCTGACAGCCCCGCCTCCAGTTCCAGGTGTGGTTATTGTCAGGCGATGTCAGACTGTGGTGGATATAGTGGCTACGATTGGGTAAGATGTGACTGGGGATCCCTCGTGAGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAAA

#1309 vh3
199
>IGHV3-43*01 0/20/5 IGHD1-7*01 3/11/2 IGHJ4*02  [IGH] BUG
200
201
202
203
204
205
206
207
208
209
210
CCCATGCATACTTTGATGATTATACCATGCACTGGGTCCGTCAAGCTCCGGGGAAGGGTCTGGAGTGGGTCTCTCTTATTAGTTGGGATGGTGGTAGCACATACTATGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACAGCAAAAACTCCCTGTATCTGCAAATGAACAGTCTGAGAACTGAGGACACCGCCTTGTATTACTGTGCAAAAGATATAGGAGGCGCGAGACGGAAAAACTGGAACCCGGAAGGGGGTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAA

#gos269 vh3
>IGHV3-30-3*01 IGHD3-9*01 IGHJ6*03  [IGH]
GCCAGGGATACTTCGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGATGGAAGCAATAAATACTACGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCCCGTAGGGCTGGTTATTATAACGTGGGATACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAGGTAA

#gos268 vh3
>IGHV3-30*18 0/5/0 IGHD4-11*01 0/2/0 IGHJ6*02  [IGH]
GGCAATTCATCCTTCGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGATGGAAGTAATAAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAAAGAGGGGATGACTACAGTAACTACCAATTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTA

#gos268 dh2
211
>IGHD2-2*01 5/11/11 IGHJ6*02  [IGH+] BUG
212
213
214
GGGTTTCGGACAAAAACCCCCTGGAAATCATAGTATCAGCAGGAGAACTAGCCAGAGACAGCAAGAGGGGACTCAGTGACTCCCGCGGGGACAGGAGGATTTTGTGGGGGCTCGTGTCACTGTGAGGATATTGTAGTAGTACCAGCTGCTCGGGGGCCAGTTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGT

#gos268 dh4
215
>IGHD4-11*01 0/2/0 IGHJ6*02  [IGH+] BUG
216
217
218
AGGGGCAAGAACGCCTGGACAGGGCCTGCGTGGGAAAGGCCTCTGGGCACACTCAGGGGCTTTTTGTGAAGGGTCCACAAAAAAGTGTGACTACAGTAACTACCAATTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCCCGTCTCCTCAGGTA

#gos267 vh3
219
>IGHV3-13*01 2/17/3 IGHJ5*02  [IGH] BUG
220
221
222
GGGGGGTCCTTCGGTAGCTACGACATGCACTGGGTCCGCCAAGCTACAGGAAAAGGTCTGGAGTGGGTCTCAGCTATTGGTACTGCTGGTGACACATACTATCCAGGCTCCGTGAAGGGCCGATTCACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTCAAATGAACAGCCTGAGAGCCGGGGACACGGCTGTGTATTACTGTGCAAGACCCCAGGAAAGAATCAGATTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTA

#gos265 vh3
223
>IGHV3-64*06 2/5/0 IGHD7-27*01 6/1/6 IGHJ4*02  [IGH] BUG
224
225
226
227
228
229
230
GGGAATCCTTCGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGGAAGGGACTGGAATATGTTTCAGCTATTAGTAGTAATGGGGGTAGCACATACTACGCAGACTCCGTGAAGGGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAGCAGTCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGTGAAAAACCCCTAACCTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTA

#gos265 dh1
>IGHD1-20*01 2/15/0 IGHJ3*02  [IGH+]
GGGTTCGCTAGCTGGGGCCCCAGTGCTCACCCCACACCTAAAGCGAGCCCCAGCCTCCAGAGCCCCCTAAGCATTCCCCGCCCAGCAGCCCAGCCCCTGCCCCCACCCAGGAGGCCCCAGAGCTCAGGGCGCCTGGTCGGATTCTGAACAGCCCCGAGTCACAGTGGGTATAACTGGAACGGCTCTTCGGCCCCCTTGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCCTCAGG

#gos261 vh4
231
>IGHV4-30-4*01 30/5/7 IGHD1-26*01 7/6/3 IGHJ2*01  [IGH] BUG
232
233
234
235
236
237
238
CCGTTCTACTGCACTGTCTCTGGTGGCTCCATCAGCAGTGGTGATTACTACTGGAGTTGGATCCGCCAGCCCCCAGGGAAGGGCCTGGAGTGGATTGGGTACATCTATTACAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTTACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACTGCCGCTTCCATGGGAGGGTCCGCTGGTACTTCGATCTCTGGGGCCGTGGCACCCTGGTCACCGTCTCCTCAGGT

#gos260 vh1
>IGHV1-8*01 0/12/9 IGHD2-8*01 5/7/5 IGHJ5*02  [IGH]
CTGTAGGACTCCTGCAGGCTTCTGGATACACCTTCACCAGTTATGATATCAACTGGGTGCGACAGGCCACTGGACAAGGGCTTGAGTGGATGGGATGGATGAACCCTAACAGTGGTAACACAGGCTATGCACAGAAGTTCCAGGGCAGAGTCACCATGACCAGGAACACCTCCATAAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGGGGGGGAGAAAAATACTAATGGTGTATGCTCCCCAGGTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAAAAA

#gos260 vh3
239
>IGHV3-33*01 1/15/8 IGHD4-17*01 3/5/4 IGHJ5*02  [IGH] BUG
240
241
242
GGGGGATCCTTCGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATGGTATGATGGAAGTAATAAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGCCCCGGGCGTGACGCGTGACGGGGGCTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAA

#kw226 vh1
243
>IGHV1-NL1*01 1/10/6 IGHD6-19*01 0/8/5 IGHJ6*02  [IGH] BUG
244
245
246
247
248
249
250
CGGTCAAGGTCTCCTGCCAGGCTTCCAGATACACCTTCACCAAATACTTTACACAGTGGGTGCGACAGGGCCCTGGACAAGGGCATAGTGGTTGGGATGCATCAACCCTTACAATGATAACACACACTACGCACAGAAGTTCCGGGGCAGAGTCACCATTACCAGTGACAGGTCTGTGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACATGGTCGTGTATTCCTGTGTGAGAGTGGGCGCTACAGCAGTGGCTGGTACAGCAAGGGTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTACCT

#kw226 dh2
>IGHD2-2*02 2/6/0 IGHJ6*02  [IGH+]
ATTCGACAAAACCCCCTGGAATCATAGTATCAGCAGGAGAACTAGCCAGAGACAGCAAGAGGGGACTCAGTGACTCCCGCGGGGACAGGAGGATTTTGTGGGGGCTCGTGTCACTGTGAGGATATTGTAGTAGTACCAGCTGCTATAGAGGGGATTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTA

#kw224 vh3(s)
251
>IGHV3-13*01 0/11/9 IGHD6-19*01 1/2/3 IGHJ4*02  [IGH] BUG
252
253
254
GGGGGGATCCCTTCGGTAGCTACGACATGCACTGGGTCCGCCAAGCTACAGGAAAAGGTCTGGAGTGGGTCTCAGCTATTGGTACTGCTGGTGACACATACTATCCAGGCTCCGTGAAGGGCCGATTCACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTCAAATGAACAGCCTGAGAGCCGGGGACACGGCTGTGTATTACTGTGCAAGAGATTAGAAGAAGGAGTGGCTGGTAGCACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCGATCAGGTAAAAC

#kw224 vh3(l)
255
>IGHV3-21*01 15/5/15 IGHD2-2*01 2/37/2 IGHJ5*02  [IGH] BUG
256
257
258
GCTTGGAATCCTTCGTAGCTATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATTAGTAGTAGTAGTAGTTACATATACTACGCAGACTCAGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTACTTCTTACCAGCTGCTATGAGGGGGCGACCAGACCGGCGCGTAGTTCTCGGGGGGGAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCGCAGGTA

#kw223 vh2
259
>IGHV2-5*01 4/6/6 IGHD6-6*01 0/1/8 IGHJ4*02  [IGH] BUG
260
261
262
TTCCACAGACCCTCACGCTGACCTGCACCTTCTCTGGGTTCTCACTCAGCACTAGTGGAGTGGGTGTGGGCTGGATCCGTCAGCCCCCAGGAAAGGCCCTGGAGTGGCTTGCACTCATTTATTGGAATGATGATAAGCGCTACAGCCCATCTCTGAAGAGCAGGCTCACCATCACCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAACATGGACCCTGTGGACACAGCCACATATTACTGTGCACTCCTTTGAAGCAGCTCGTCCGGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCGTCAGGTAAAA

#kw222 vh3
263
>IGHV3-13*01 6/9/12 IGHD2-2*01 3/4/0 IGHJ6*02  [IGH] BUG
264
265
266
CGCATCCTTCGTAGCTACGACATGCACTGGGTCCGCCAAGCTACAGGAAAAGGTCTGGAGTGGGTCTCAGCTATTGGTACTGCTGGTGACACATACTATCCAGGCTCCGTGAAGGGCCGATTCACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTCAAATGAACAGCCTGAGAGCCGGGGACACGGCTGTGTATTACTGTGCCCTCCGACCTAGTACCAGCTGCTATCCCTATTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGT

#kw221 vh3
267
>IGHV3-19*01 14/6/2 IGHD3-10*01 6/0/2 IGHJ4*02  [IGH] BUG
268
269
270
271
272
273
GGAATGAATCCTTCGTACTTGACATGAACTGGGTCCGCCAGGCTCCAGGAAAGGGGCTGGAGTGGGTATCGGGTGTTACTTATAATGGAAGTAGGACGCACTATGCAGACTCTGTAAAGGGCCGATTCATCATCTCCAGAGACAATTCCAGGAACTTCCTGTATCAGCAAATGAACAGCCTGAGGCCCGAGGACATGGCTGTGTATCCTTGAATTACTATGGTTCGGGGAGTTATTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACAGTCTCCTCAGGTCAAACCTGGTATTATACGGACGGCAGTTCTCACTCTCCGCTGGACCTTTGCCATCAGCGTGTTCTTGGAATTGCCCCTGGACCTGGTTGAATGTTACTTAACAAACCCTCA

#kw220 vh3
>IGHV3-30*18 0/9/7 IGHD3-22*01 9/13/5 IGHJ4*02  [IGH]
GGATTGGAAAACTTCAGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGATGGAAGTAATAAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAAAGATGGTTTCCTTATGATAGTAGTGGTCCCCCCCTCCTTTTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAACCC