no-cdr3.fasta 285 Bytes
Newer Older
1 2
>seq1
GGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATTAGTAGTAGTAGTAGTTACATATACTACGCAGACTCAGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGAGGTGGTTATCCTTCCTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGT