segment_simul.should-get 1.34 KB
Newer Older
1
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -v -g $VIDJIL_DIR/germline -c segment $VIDJIL_DATA/segment_simul.fa | grep '^[>#]'
Mikaël Salson's avatar
Mikaël Salson committed
2 3


Mathieu Giraud's avatar
Mathieu Giraud committed
4
$ First sequence, easy segmentation (no error, few deletions at the windows, small N)
Mikaël Salson's avatar
Mikaël Salson committed
5 6 7 8
#                         72   77          89   94
#                         |    |           |    |
# seq    :  61 attactgtgcgaCTTCataaccggaaccaGTTAtggttcgactcctggggccaaggaaccctggtcaccgtctcctcag
#              ||||||||||||                     ||||||||||||||||||||||||||||||||||||||||||||||
Mathieu Giraud's avatar
Mathieu Giraud committed
9
# V5-10-1: 280 attactgtgcgaga  |||||||||||||
Mikaël Salson's avatar
Mikaël Salson committed
10
# D1-14*01:  1              ggtataaccggaaccac
11 12
#                                          |||||||
# D3-16*01:          gtattatgattacgtttgggggaGTTATGcttatacc
Mikaël Salson's avatar
Mikaël Salson committed
13 14
# J5*01   :  1                             acaactggttcgactcctggggccaaggaaccctggtcaccgtctcctcag
# -2/CTTC/-3  -1/GTTA/5
15
1:^>seq1 \+ VDJ 1 73 78 90 95 140 IGHV5-10-1.0[1-4] 2/CTTC/3 IGHD1-14.01 1/GTTA/5 IGHJ5.01
Mikaël Salson's avatar
Mikaël Salson committed
16

17 18 19
# Note that a second D (D3-16*01) can be detected (6 common nucleotides, or even 7 with an overlap on the first D)
# This is tested in segment_simul.should-vdj

20
$ seq1_polyT is the same as seq1 but starts and ends with 10Ts, the recombination is in the middle. start position should not be 0 and end position should not be length-1; See #2138
21
f1:^>seq1_polyT \\+ VDJ 11 83 88 100 105 150 IGHV5-10-1.0[1-4] 2/CTTC/3 IGHD1-14.01 1/GTTA/5 IGHJ5.01