stanford-json.should-get 2.35 KB
Newer Older
1
!REQUIRES: python $VIDJIL_DIR/tools/check_python_version.py
2
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -3 -z 1 -G $VIDJIL_DIR/germline/IGH -w 60 -r 5 -e 10 -b data  $VIDJIL_DIR/data/Stanford_S22.fasta > /dev/null ; cat out/data.vidjil | python $VIDJIL_DIR/tools/format_json.py -1
3
4

$ Number of reads
5
e1:"total": [13153]
6
7

$ Number of segmented reads
8
e1:"segmented": [13153]
9
10

$ Most abundant window
11
1:"id": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC".*"reads": \\[8\\]
12

13
14
15
$ Affect values are over all the sequence
1: "affectValues": .[^}]*"start": 1, "stop": 128

16
17
$ Segmentation
1:"name": "IGHV3-23.05 6/ACCCGGGAGGAACAATAT/9 IGHD6-13.01 0//5 IGHJ4.02"
18

19
20
#                                                     Cys-T-=R=-E-=E=-Q-=Y=-S-=S=-W-=Y=-F-=D=-F-Trp
#          1         2         3         4         5  | *|  6         7   *     8    **   9    |  |10        11        12
21
22
23
24
25
26
27
28
# 12345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678
# 5-----------------------------------------------------5N----------------ND----------DJ-----------------------------------------J
# GCTGTACCTGCAAATGAACAGCCTGCGAGCCGAGGACACGGCCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCCAGGGGATCCTGGTCACCGTCTCCTCAG
#                                                        ACCCGGGAGGAACAATAT
#                                                                          agcagctggtac
# 5(V): 1 -> 55
# 4(D): 74 -> 85
# 3(J): 86 -> 128
29
30
# CDR3: 56 -> 94
# JUNCTION: 53 -> 97
31

32
$ Segmentation details - V
33
1:"5": ."delRight": 6, "name": "IGHV3-23.05", "stop": 55.
34
35

$ Segmentation details - D
36
1:"4": ."delLeft": 9, "delRight": 0, "name": "IGHD6-13.01", "start": 74, "stop": 85.
37
38

$ Segmentation details - J
39
1:"3": ."delLeft": 5, "name": "IGHJ4.02", "start": 86.
40
41
42
43
44

$ Segmentation details - N1, N2
1:"N1": 18,
1:"N2": 0,

45
46
47
48
$ Segmentation details - CDR3, JUNCTION
1:"cdr3": ."aa": "TREEQYSSWYFDF", "start": 56, "stop": 94.
1:"junction": ."aa": "CTREEQYSSWYFDFW", .* "start": 53, "stop": 97.

49
50
51
52
$ Second sequence has a DNA sequence provided
1:"id": "CTGTGCGAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACTACTA".*"sequence": "[ACGT]+",

$ Second sequence also has evalues
53
1:"id": "CTGTGCGAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACTACTA".*"evalue": ."val": "[0-9\.e-]+"
54
55
56

$ All 'start' fields are 1-based, they never equal to zero
0: "start": 0