igh-vdj.should-vdj.fa 515 Bytes
Newer Older
Mathieu Giraud's avatar
Mathieu Giraud committed
1
>IGHV1-18*01 0//0 IGHD1-1*01 0//0 IGHJ1*01 [IGH] BUG
2 3 4 5
actgtgcgagaga
ggtacaactggaacgac
gctgaatacttcc

6 7 8 9 10 11 12 13 14 15
>IGHV1-18*01 0//0 IGHD3-16*01 0//0 IGHJ4*01
agcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagaga
gtattatgattacgtttgggggagttatgcttatacc
actactttgactactggggccaaggaaccctggtcaccgtctcctcag

# Same sequence, but with only the 20bp start of J
>IGHV1-18*01 0//0 IGHD3-16*01 0//0 IGHJ4*01
agcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagaga
gtattatgattacgtttgggggagttatgcttatacc
actactttgactactggggcc