Mise à jour terminée. Pour connaître les apports de la version 13.8.4 par rapport à notre ancienne version vous pouvez lire les "Release Notes" suivantes :
https://about.gitlab.com/releases/2021/02/11/security-release-gitlab-13-8-4-released/
https://about.gitlab.com/releases/2021/02/05/gitlab-13-8-3-released/

algo-then-fuse.should 788 Bytes
Newer Older
1
!REQUIRES: python $VIDJIL_DIR/tools/check_python_version.py
Mathieu Giraud's avatar
Mathieu Giraud committed
2 3 4 5 6

!OUTPUT_FILE: out/algo-then-fuse.vidjil
!OPTIONS: --mod jR

!LAUNCH: $VIDJIL_DIR/$EXEC -r 1 -z 0 -w 60 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta ; python $VIDJIL_DIR/tools/fuse.py out/Stanford_S22.vidjil out/Stanford_S22.vidjil -o out/algo-then-fuse.vidjil
7 8

$ Points list
Mathieu Giraud's avatar
Mathieu Giraud committed
9 10 11
2:samples.original_names
:samples.original_names[0]: data//Stanford_S22.fasta
:samples.original_names[1]: data//Stanford_S22.fasta
12

Mathieu Giraud's avatar
Mathieu Giraud committed
13 14 15 16
$ Most abundant window, twice, fused
:clones[0].id: CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC
:clones[0].reads: [8, 8]
:clones[0].top: 1
17

18
$ Windows that are not in the bottom of the distribution
Mathieu Giraud's avatar
Mathieu Giraud committed
19 20
#  :reads.distribution.0.00001:  should#59
:reads.distribution: [9062, 9062]